http://genomecore.wi.mit.edu/api.php?action=feedcontributions&user=Sgupta&feedformat=atomGenome Technology Core (GTC) wiki - Sequencing and Microarray - User contributions [en]2024-03-28T12:26:23ZUser contributionsMediaWiki 1.29.2http://genomecore.wi.mit.edu/index.php?title=Sumeet_Gupta&diff=18799Sumeet Gupta2024-01-31T12:53:37Z<p>Sgupta: Replaced content with "{| style="text-align: left; width:90%" | right Sumeet Gupta <br> Bioinformatics and Sequencing Supervisor, <br> Phone: 617-324-0339..."</p>
<hr />
<div>{| style="text-align: left; width:90%"<br />
|<br />
[[image:Sumeet.jpg|right]]<br />
[[Sumeet_Gupta| Sumeet Gupta]] <br><br />
Bioinformatics and Sequencing Supervisor, <br><br />
Phone: 617-324-0339 <br><br />
Email: sgupta at wi dot mit dot edu <br><br />
|}</div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Sumeet_Gupta&diff=18798Sumeet Gupta2024-01-31T12:53:16Z<p>Sgupta: </p>
<hr />
<div>{| style="text-align: left; width:90%"<br />
|<br />
[[image:Sumeet.jpg|right]]<br />
[[Sumeet_Gupta| Sumeet Gupta]] <br><br />
Bioinformatics and Sequencing Supervisor, <br><br />
Phone: 617-324-0339 <br><br />
Email: sgupta at wi dot mit dot edu <br><br />
|}<br />
<br />
= Frequently Asked Questions =<br />
== Solexa Data Processing ==<br />
=== Is the Phix control useful for the analysis? ===<br />
<br />
Yes. The control does allow us to distinguish between a cluster generation/sequencing issue vs a library/sample prep issue. In addition, it is useful to calculate the phasing and prephasing parameters (used to access the sequencing "efficiency") for the solexa base calling step which assumes a random distribution of bases. If we do not have a random distribution, it would lead to wrong base calls and worse quality scores, eventually leading to loss of data.<br />
<br />
=== Do we filter "bad" reads from the final dataset? [06/19/09] ===<br />
<br />
The default Illumina pipeline quality filter is used, which uses a threshold of CHASTITY >= 0.6. Chastity for a given base call is defined as "the ratio of the highest of the four (base type) intensities to the sum of highest two." This filter is used to identify clusters with a low signal to noise ratio, often as a result of two adjacent clusters being so physically close together that their signals cannot be measured independently.<br />
<br />
We do NOT remove the filtered reads from the final dataset but we do mark each read ID with a boolean system indicating 1 for good/Not Filered reads and 0 for bad/filtered reads.<br />
<br />
=== Was solexa pipeline version 1.3+ used for processing my data? ===<br />
<br />
Use the "grep" command in unix to do a search for the characters unique to the Solexa older pipeline i.e. any of these characters in red below. If they are, then the data was generated using an older pipeline than 1.3.<br />
<br />
...............................IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII......................<br />
..........................XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX<br />
!"#$%&'()*+,-./0123456789:<font color="red">;<=>?</font>@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~<br />
| | | | | |<br />
33 59 64 73 104 126<br />
<br />
I - Illumina 1.3 Phred+64, 41 values (0, 40)<br />
X - Solexa Solexa+64, 68 values (-5, 62)<br />
Courtesy: http://en.wikipedia.org/wiki/FASTQ_format<br />
<br />
<br />
== Solexa Quality Scores ==<br />
=== What is the format of the quality scores files (fasta files)? ===<br />
<br />
@4:1:518:715 <br><br />
GATACCATAAAAGCTGGATCCTTCTTCAAGCATAA <br><br />
+4:1:518:715 <br><br />
hhhhhhhhhhhhhhhdhhhhhhhhhhhdRehdhhP <br><br />
<br />
@ID <br><br />
Sequence <br><br />
+ID <br><br />
Quality Scores for each base (String of characters) <br><br />
<br />
=== What do the quality scores for each base mean? ===<br />
<br />
'''Old''' Solexa/Illumina pipeline FASTQ files used '''Solexa scores''' with an ASCII offset 64. '''New''' Solexa/Illumina 1.3+ pipeline FASTQ files use '''PHRED scores''' with an ASCII offset 64. These differ at the low end of the range of possible quality score with solexa scores allowing negative numbers. At Q scores above ~11 the two are very similar as indicated by the line plot below (Courtesy: Illumina).<br />
<br />
[[image:Qsolphred.png|center]]<br />
<br />
!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~<br />
| | | | | |<br />
33 59 64 73 104 126<br />
<br />
Illumina 1.3 Phred+64, 41 values (0, 40)<br />
Solexa Solexa+64, 68 values (-5, 62)<br />
Courtesy: http://en.wikipedia.org/wiki/FASTQ_format<br />
<br />
P(error) - Probability of the base call being incorrect. <br><br />
<br />
{| cellpadding="2" style="border:1px solid darkgray;"<br />
|-<br />
|Char||ASCII||Char-64||P(error)<br />
|-<br />
|;||59||-5||0.7597<br />
|-<br />
|<||60||-4||0.7153<br />
|-<br />
|=||61||-3||0.6661<br />
|-<br />
|>||62||-2||0.6131<br />
|-<br />
|?||63||-1||0.5573<br />
|-<br />
|@||64||0||0.5<br />
|-<br />
|A||65||1||0.4427<br />
|-<br />
|B||66||2||0.3869<br />
|-<br />
|C||67||3||0.3339<br />
|-<br />
|D||68||4||0.2847<br />
|-<br />
|E||69||5||0.2403<br />
|-<br />
|F||70||6||0.2008<br />
|-<br />
|G||71||7||0.1663<br />
|-<br />
|H||72||8||0.1368<br />
|-<br />
|I||73||9||0.1118<br />
|-<br />
|J||74||10||0.0909<br />
|-<br />
|K||75||11||0.0736<br />
|-<br />
|L||76||12||0.0594<br />
|-<br />
|M||77||13||0.0477<br />
|-<br />
|N||78||14||0.0383<br />
|-<br />
|O||79||15||0.0307<br />
|-<br />
|P||80||16||0.0245<br />
|-<br />
|Q||81||17||0.0196<br />
|-<br />
|R||82||18||0.0156<br />
|-<br />
|S||83||19||0.0124<br />
|-<br />
|T||84||20||0.0099<br />
|-<br />
|U||85||21||0.0079<br />
|-<br />
|V||86||22||0.0063<br />
|-<br />
|W||87||23||0.005<br />
|-<br />
|X||88||24||0.004<br />
|-<br />
|Y||89||25||0.0032<br />
|-<br />
|Z||90||26||0.0025<br />
|-<br />
|[||91||27||0.002<br />
|-<br />
|\||92||28||0.0016<br />
|-<br />
|]||93||29||0.0013<br />
|-<br />
|^||94||30||0.001<br />
|-<br />
|_||95||31||0.0008<br />
|-<br />
|`||96||32||0.0006<br />
|-<br />
|a||97||33||0.0005<br />
|-<br />
|b||98||34||0.0004<br />
|-<br />
|c||99||35||0.0003<br />
|-<br />
|d||100||36||0.0003<br />
|-<br />
|e||101||37||0.0002<br />
|-<br />
|f||102||38||0.0002<br />
|-<br />
|g||103||39||0.0001<br />
|-<br />
|h||104||40||0.0001<br />
|-<br />
|}<br />
<br />
=== Is solexa quality same as phred quality scores? ===<br />
The Solexa quality and Phred quality are asymptotically identical but NOT the same. If the error probability of a base is $e, the Solexa quality $sQ is: <br />
$sQ = -10 * log($e / (1 - $e)) / log(10);<br />
<br />
Solexa quality $sQ can be converted to Phred quality $Q with this formula: <br />
$Q = 10 * log(1 + 10 ** ($sQ / 10.0)) / log(10); <br />
<br />
== Alignment of Next Generation Sequencing Reads ==<br />
<br />
=== What is Eland? ===<br />
ELAND stands for E fficient L arge-Scale A lignment of N ucleotide D atabases. ELAND is a alignment tool developed by Illumina/Solexa which searches a set of large DNA files for a large number of short DNA reads allowing up to 2 errors per match.<br />
<br />
=== How can Eland be faster relative to some other alignment programs? ===<br />
Given a sequence of length N, it can be divided into four subsequences (A, B, C, and D), which are of equal (or nearly equal length). Assuming there are no more than 2 errors, at least two of these subsequences will be "error free", so that the two error free sequences can then be searched for in a database containing all possible subsequences in the genome of interest. Thus, you can search your database for the subsequence AB and CD. Searching for the {AB and CD} subsequences would only work if the first half of your sequence has no errors. What if B and C had the errors? The answer is to shuffle your subsequences to make other combinations: ({AB and CD}, {AC and BD}, {AD and CD}, {BA and CD}, etc.). This still provides you with a relatively small search space for each sequence, as there are only 4! possible combinations (which is 4x3x2x1 = 24 possible sequences) to search for. This can be bound even further because the first pair and second pair are in the correct order, (ie {AB and CD} and {AC and BD} are ok, but {CA and DB} and {BA and DC} would give you an incorrect result) limiting you to only six possible combinations, which still allows you to find any correct match where at least two of the four subsequences are error free.<br />
<br />
Combining these subsequences into 2 subsets rather than searching for 4 independent entries in their database speeds up the process as long as one set matches (matching criteria on the other set can be relaxed, ie, allowing for mismatches). That is to say, if you make two sequences out of the 4 subsequences {AB and CD}, you can search for an exact match for AB, and test all the possible results for mismatches in the {CD} portion of the sequence. This has the effect of significantly reducing the search space. (Only sequences containing the exact match to {AB})<br />
<br />
=== Are their other alignment programs? ===<br />
* '''Iterative ELAND''' - This algorithm, developed at the core by Sumeet Gupta, iteratively checks shorter reads to attempt to recover non-matching reads. (Currently requests are made to Sumeet Gupta for alignments but a stable version would soon be released which would also report positions if read maps at multiple positions).<br />
<br />
* '''MAQ''' - Maq stands for Mapping and Assembly with Quality. It builds assembly by mapping short reads to reference sequences. Maq is a project hosted by SourceForge.net. The project page is available at http://sourceforge.net/projects/maq/.<br />
<br />
* '''Bowtie''' - Bowtie is an ultrafast, memory-efficient short read aligner. It indexes the genome with a Burrows-Wheeler index to keep its memory footprint small: typically about 2.2 GB for the human genome (2.9 GB for paired-end). It supports alignment policies equivalent to Maq and SOAP but is substantially faster.<br />
<br />
== File Formats ==<br />
* '''QC File Format Based on Quality Scores''' - http://jura.wi.mit.edu/genomecorewiki/index.php/QCOutputFormat</div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Personnel&diff=18797Personnel2024-01-31T12:52:49Z<p>Sgupta: </p>
<hr />
<div>{| style="background:white; color:black; width:800px" align="center"<br />
|<br />
{| style="border:1px solid purple; width:400px; height:150px; text-align: center"<br />
| <br />
{| style="text-align: left; width:90%"<br />
|<br />
[[image:Tom.jpg|right]]<br />
[[Tom_Volkert| Tom Volkert]] <br><br />
Director, <br><br />
Phone: 617-258-5094 <br><br />
Email: volkert at wi dot mit dot edu<br />
|}<br />
|}<br />
||<br />
{| style="border:1px solid purple; width:400px; height:150px; text-align: center"<br />
|<br />
{| style="text-align: left; width:90%" <br />
|<br />
[[image:Jen.jpg|right]]<br />
[[Jennifer_Love| Jennifer Love]] <br><br />
Technical Associate II, Core Supervisor, <br><br />
Phone: 617-258-8803 <br><br />
Email: jlove at wi dot mit dot edu <br><br />
|}<br />
|}<br />
|<br />
|}<br />
{| style="background:white; color:black; width:800px" align="center"<br />
|<br />
{| style="border:1px solid purple; width:400px; height:150px; text-align: center"<br />
| <br />
{| style="text-align: left; width:90%"<br />
|<br />
[[image:Sumeet.jpg|right]]<br />
[[Sumeet_Gupta| Sumeet Gupta]] <br><br />
Bioinformatics and Sequencing Supervisor, <br><br />
Phone: 617-324-0339 <br><br />
Email: sgupta at wi dot mit dot edu <br><br />
|}<br />
|}<br />
||<br />
{| style="border:1px solid purple; width:400px; height:150px; text-align: center"<br />
| <br />
{| style="text-align: left; width:90%" <br />
|<br />
[[image:stephen.jpg|right]]<br />
[[Stephen Mraz III| Stephen Mraz III]] <br><br />
Technical Assistant II, <br><br />
Phone: 617-258-8803 <br><br />
Email: sjmraz3 at wi dot mit dot edu <br><br />
|}<br />
|}<br />
|<br />
|}<br />
{| style="border:1px solid purple; width:400px; height:150px; text-align: center" align="center"<br />
| <br />
{| style="text-align: left; width:90%" <br />
|<br />
[[image:amanda.jpg|right]]<br />
[[Amanda_Chilaka| Amanda Chilaka]] <br><br />
Technical Assistant II, <br><br />
Phone: 617-258-8803 <br><br />
Email: achilaka at wi dot mit dot edu <br><br />
|}<br />
|}</div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Main_Page&diff=18796Main Page2023-09-25T16:15:28Z<p>Sgupta: </p>
<hr />
<div>{| style="font-style:italic; font-size:120%; width:100%; border:2px solid white; height:100px" align="center"<br />
|-<br />
| [[image:Lab-Panorama-shot-web.jpg|center]]<br />
|-<br />
|}<br />
{| style="background:white; color:black; width:800px" align="center"<br />
|<br />
{|<br />
|<br />
{| style="border:1px solid purple; width:800px; height:100px; text-align: center" align="center"<br />
| valign="top" | Services<br />
{| style="text-align: left; width:100%"<br />
|<br />
[[Pricing|'''CLICK HERE FOR PRICE LIST''']]<br />
<br />
Service Details:<br />
* [[Sequencing|Sequencing and Library Prep]] <br />
* [[SingleCell|Single Cell Sequencing]]<br />
* [[RT_PCR|Real-Time PCR]]<br />
* Bioanalyzer<br />
|}<br />
|}<br />
{| style="background:white; color:black; width:800px" align="center"<br />
|<br />
{| style="border:1px solid purple; width:400px; height:140px; text-align: center"<br />
| valign="top" | Hot Links<br />
{| style="text-align: left; width:100%" <br />
|<br />
* [https://cores.wi.mit.edu/ External Lab Customer Registration]<br />
* [[Forms|Sample Submission Forms (All Services)]]<br />
* [[SubmissionGuide|Sequencing Sample Submission Guide]]<br />
* [[Calendar|Resource Scheduling Systems for RT PCR and Covaris]]<br />
* [[faq|Frequently Asked Questions]]<br />
|}<br />
|}<br />
||<br />
{| style="border:1px solid purple; width:400px; height:140px; text-align: center"<br />
| valign="top" | Data Related Resources<br />
{| style="text-align: left; width:100%" <br />
|<br />
* [[SequencingQC|Sequencing QC]]<br />
* [[SequencingFormats|Sequencing Formats]]<br />
* Analysis - [[Scripts|Scripts]], [[Data_Analysis_Resources|Other Resources]]<br />
* [[General_Links_Resources|General Links]]<br />
* [[NCBISubmission|NCBI Submission Guide]]<br />
|}<br />
|}<br />
|<br />
|}<br />
{| style="background:white; color:black; width:800px" align="center"<br />
|<br />
{| style="border:1px solid purple; width:400px; height:120px; text-align: center"<br />
| valign="top" | Contact Us<br />
{| style="text-align: center; width:100%" <br />
|<br />
455 Main Street, <br> <br />
Cambridge, MA - 02142 <br><br />
Tel: 617-258-8803 <br><br />
[[wibr-genome at wi dot mit dot edu]]<br />
|}<br />
|}<br />
||<br />
{| style="border:1px solid purple; width:400px; height:120px; text-align: center"<br />
| valign="top" | Other General Information<br />
{| style="text-align: left; width:100%" <br />
|<br />
* [[Personnel]] - [[Tom_Volkert|Tom Volkert]], [[Jennifer_Love|Jennifer Love]], [[Sumeet_Gupta|Sumeet Gupta]], Stephen Mraz III, Amanda Chilaka<br />
|}<br />
|}<br />
|<br />
|}<br />
|}<br />
|}</div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Main_Page&diff=18795Main Page2023-09-25T16:15:14Z<p>Sgupta: </p>
<hr />
<div>{| style="font-style:italic; font-size:120%; width:100%; border:2px solid white; height:100px" align="center"<br />
|-<br />
| [[image:Lab-Panorama-shot-web.jpg|center]]<br />
|-<br />
|}<br />
{| style="background:white; color:black; width:800px" align="center"<br />
|<br />
{|<br />
|<br />
{| style="border:1px solid purple; width:800px; height:100px; text-align: center" align="center"<br />
| valign="top" | Services<br />
{| style="text-align: left; width:100%"<br />
|<br />
[[Pricing|'''CLICK HERE FOR PRICE LIST''']]<br />
<br />
Service Details:<br />
* [[Sequencing and Library Prep|Sequencing]] <br />
* [[SingleCell|Single Cell Sequencing]]<br />
* [[RT_PCR|Real-Time PCR]]<br />
* Bioanalyzer<br />
|}<br />
|}<br />
{| style="background:white; color:black; width:800px" align="center"<br />
|<br />
{| style="border:1px solid purple; width:400px; height:140px; text-align: center"<br />
| valign="top" | Hot Links<br />
{| style="text-align: left; width:100%" <br />
|<br />
* [https://cores.wi.mit.edu/ External Lab Customer Registration]<br />
* [[Forms|Sample Submission Forms (All Services)]]<br />
* [[SubmissionGuide|Sequencing Sample Submission Guide]]<br />
* [[Calendar|Resource Scheduling Systems for RT PCR and Covaris]]<br />
* [[faq|Frequently Asked Questions]]<br />
|}<br />
|}<br />
||<br />
{| style="border:1px solid purple; width:400px; height:140px; text-align: center"<br />
| valign="top" | Data Related Resources<br />
{| style="text-align: left; width:100%" <br />
|<br />
* [[SequencingQC|Sequencing QC]]<br />
* [[SequencingFormats|Sequencing Formats]]<br />
* Analysis - [[Scripts|Scripts]], [[Data_Analysis_Resources|Other Resources]]<br />
* [[General_Links_Resources|General Links]]<br />
* [[NCBISubmission|NCBI Submission Guide]]<br />
|}<br />
|}<br />
|<br />
|}<br />
{| style="background:white; color:black; width:800px" align="center"<br />
|<br />
{| style="border:1px solid purple; width:400px; height:120px; text-align: center"<br />
| valign="top" | Contact Us<br />
{| style="text-align: center; width:100%" <br />
|<br />
455 Main Street, <br> <br />
Cambridge, MA - 02142 <br><br />
Tel: 617-258-8803 <br><br />
[[wibr-genome at wi dot mit dot edu]]<br />
|}<br />
|}<br />
||<br />
{| style="border:1px solid purple; width:400px; height:120px; text-align: center"<br />
| valign="top" | Other General Information<br />
{| style="text-align: left; width:100%" <br />
|<br />
* [[Personnel]] - [[Tom_Volkert|Tom Volkert]], [[Jennifer_Love|Jennifer Love]], [[Sumeet_Gupta|Sumeet Gupta]], Stephen Mraz III, Amanda Chilaka<br />
|}<br />
|}<br />
|<br />
|}<br />
|}<br />
|}</div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=NCBISubmission&diff=18794NCBISubmission2023-09-25T14:26:37Z<p>Sgupta: </p>
<hr />
<div>= Prep Descriptions =<br />
<br />
=== Swift ChIP-Seq ===<br />
Libraries were prepared for ChIP-Seq using Swift Science’s Accel-NGS Library Preparation Kit for Illumina Platforms according to manufacturer’s directions. The swift kit makes library from 10pg-100ng of double stranded input material. Briefly, the sample undergoes a series of incubations and purifications. The sample, through multiple incubations, repairs both 5’ and 3’ termini and sequentially attaches Illumina adapter sequences to the ends of fragmented dsDNA. The multiple bead-based clean-ups are used to remove oligonucleotides and small fragments, and to change enzymatic buffer composition between steps.<br />
<br />
=== xGen Broad-Range RNA Library Prep Kit (IDT) - Formally Swift Std RNA Library Prep Kit ===<br />
Libraries were prepared for RNA-Seq using IDT’s xGen Broad-Range RNA Library Prep Kit, according to manufacturer’s directions. First, total RNA (10 ng – 1 ug) is enriched for polyadenylated sequences using NEBNext poly(A) mRNA Magnetic Isolation Module (NEB). The enriched mRNA fraction is then fragmented, and first-strand cDNA is generated using random primers. Via an “Adaptase” step, simultaneous tailing and ligation add a “stubby adapter” to the 3’ ends of the cDNA. A subsequent extension step generates dsDNA, and then a second adapter is ligated onto the extension product. A final PCR amplification step adds indexes and sequences needed for flow cell binding. Strand specificity is achieved by bypassing the traditional second strand cDNA synthesis step prior to adapter ligation.<br />
<br />
=== xGen Library Prep Kit (IDT) - Formally Swift Rapid RNA Library Prep Kit ===<br />
Libraries were prepared for RNA-Seq using IDT’s xGen RNA Library Prep Kit, according to manufacturer’s directions. First, total RNA (100 ng – 1 ug) is enriched for polyadenylated sequences using NEBNext poly(A) mRNA Magnetic Isolation Module (NEB). The enriched mRNA fraction is then fragmented, and first-strand cDNA is generated using random primers with a “stubby adapter” overhang. An Exonuclease step removes excess RT primers and prevents them from becoming template downstream. Via an “Adaptase” step, simultaneous tailing and ligation add a second stubby adapter. A final PCR amplification step adds indexes and sequences needed for flow cell binding. Strand specificity is achieved by bypassing the traditional second strand cDNA synthesis step prior to adapter ligation. <br />
<br />
=== KAPA HyperPrep mRNA ===<br />
Libraries were prepared for RNA-Seq using Roche Diagnostics KAPA mRNA HyperPrep Kit, according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is enriched for polyadenylated sequences using oligo-dT magnetic bead capture. The enriched mRNA fraction is then fragmented, and first-strand cDNA is generated using random primers. '''Strand specificity is achieved''' during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification. The resulting cDNA is A-Tailed and ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR.<br />
<br />
<br />
=== KAPA RNA HyperPrep Kit with RiboErase ===<br />
Libraries were prepared for RNA-Seq using the KAPA Biosystems RNA HyperPrep Kit with RiboErase, according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is ribo-depleted by hybridization of complementary DNA oligonucleotides, followed by treatment with RNase H and DNase to remove rRNA duplexed to DNA and original DNA oligonucleotides. The enriched fraction is then fragmented with heat and magnesium, and first-strand cDNA is generated using random primers. Strand specificity is achieved during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification, and the cDNA is then A-Tailed. The final double strand cDNA is then ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR. <br />
<br />
<br />
=== TruSeq PolyA ===<br />
Libraries were prepared for RNA-Seq using Illumina’s TruSeq Stranded mRNA Library Preparation Kit according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is enriched for polyadenylated sequences using oligo dT magnetic bead capture. The enriched mRNA fraction is then fragmented, and first-strand cDNA is generated using random primers. '''Strand specificity is achieved''' during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification. The resulting cDNA is A-Tailed and ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR. <br />
<br />
<br />
=== TruSeq RiboZero ===<br />
Libraries were prepared for RNA-Seq using Illumina’s TruSeq Stranded Total RNA Library Preparation Kit according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is ribo-depleted using biotinylated, target-specific oligos combined with Ribo-Zero rRNA removal beads. The enriched fraction is then fragmented, and first-strand cDNA is generated using random primers. '''Strand specificity is achieved''' during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification. The resulting cDNA is A-Tailed and ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR. <br />
<br />
<br />
=== SMARTer V4 ===<br />
<br />
Upto 10 ng of sample was prepared using Takara’s SMART-Seq v4 Ultra Low Input RNA protocol per manufacturer’s guidelines. Briefly, RNA underwent reverse transcription via template switching and amplification, resulting in double stranded cDNA. The amount of cDNA between 100-3000 bp was calculated by Fragment Analyzer and Qubit. 150pg of the sample in range was then added to Illumina’s Nextera XT and processed according to manufacturer’s guidelines. Briefly, the cDNA underwent tagmentation, using Nextera XT’s transposase, and unique dual indexes were added by PCR amplification. Final libraries went through QC with the Fragment Analyzer and qPCR on a Roche Light Cycler 480 II. All libraries were then pooled and sequenced at single-end 40 base-pair using the Illumina HiSeq 2500. Demultiplexed sequencing data was handed over.<br />
<br />
<br />
=== 10X - Single cell (Next GEM) - 3p v3 or v3.1 ===<br />
<br />
Cells were processed using the 10X Genomics Chromium Controller with the Single Cell 3ʹ v3 Reagent Kit, according to manufacturer’s directions. Briefly, a target number of cells per library was roughly achieved by loading 1.6 times the target number of cells in suspension, along with barcoded beads and partitioning oil, into the Chromium Controller, in order to create GEMs (Gel Beads in Emulsion). The Chromium Controller combines individual cells, first strand master mix, and gel beads containing barcoded oligonucleotides into single-cell droplets for first strand cDNA synthesis, so that each cell is marked with its own unique barcode during reverse transcription. The 3’ beads contain a poly(dT) oligo that enables the production of barcoded, full-length cDNA from poly-adenylated mRNA. After first strand synthesis is complete, the emulsion is dissolved and the cDNA is pooled for bulk processing as a single sample. The sample is fragmented, end-repaired, A-tailed and ligated with universal adapters. A second sample barcode is then added during the PCR step, allowing for unique library identification. The end result is a single library representing one cell suspension, containing data for each individual cell.<br />
<br />
<br />
'''Genome core switched to v3 kit in May 2019. Some preps may have been done in v2 due to specific requests from users. Typically the lane annotation file's prep method column would indicate if v3 was used for the preps'''<br />
<br />
=== 10X - Single cell (Next GEM) - 5p v2 ===<br />
<br />
Cells were processed using the 10X Genomics Chromium Controller with the Single Cell 5ʹ v2 Reagent Kit, according to manufacturer’s directions. Briefly, a target number of cells per library was roughly achieved by loading 1.6 times the target number of cells in suspension, along with barcoded beads and partitioning oil, into the Chromium Controller, in order to create GEMs (Gel Beads in Emulsion). The Chromium Controller combines individual cells, first strand master mix, and gel beads containing barcoded oligonucleotides into single-cell droplets for first strand cDNA synthesis, so that each cell is marked with its own unique barcode during reverse transcription. The 5’ beads contain a template switching oligo that, combined with a poly(dT) primer, enables the production of barcoded, full-length cDNA from poly-adenylated mRNA. After first strand synthesis is complete, the emulsion is dissolved and the cDNA is pooled for bulk processing as a single sample. The sample is fragmented, end-repaired, A-tailed and ligated with universal adapters. A second sample barcode is then added during the PCR step, allowing for unique library identification. The end result is a single library representing one cell suspension, containing data for each individual cell.<br />
<br />
=== 10X - Single Cell (Next GEM 5’) – V(D)J ===<br />
Amplified full-length cDNA from mRNA generated using the Next GEM 5’ kit is used to amplify full-length V(D)J segments via PCR amplification with primers specific to either the TCR or BCR constant regions. Enzymatic fragmentation and size selection are used to generate variable length fragments that collectively span the V(D)J segments of the amplified TCR or BCR transcripts prior to library construction. The sample is then fragmented, end-repaired, A-tailed and ligated with universal adapters. A second sample barcode is then added during the PCR step, allowing for unique library identification.<br />
<br />
=== 10X - Single Cell (Next GEM) - Multiome – 3’ GEX and ATAC ===<br />
<br />
Nuclei were processed using the 10X Genomics Chromium Controller with the Next GEM Single Cell Multiome Reagent Kit, according to manufacturer’s directions. Briefly, nuclei suspensions are incubated in a Transposition Mix that includes a Transposase. The Transposase enters the nuclei and preferentially fragments the DNA in open regions of the chromatin. Simultaneously, adapter sequences are added to the ends of the DNA fragments. Transposed nuclei are combined with barcoded beads and partitioning oil into the Chromium Controller, in order to create GEMs (Gel Beads in Emulsion). Single Cell Multiome ATAC + GEX Gel Beads include both a poly(dT) sequence that enables production of barcoded, full-length cDNA from poly-adenylated mRNA for the gene expression library, and a Spacer sequence that enables barcode attachment to transposed DNA fragments for the ATAC library. A pre-amplification step provides template material for both downstream ATAC and gene expression library production. <br />
<br />
To produce the ATAC library, P7 and a sample index are added to pre-amplified, transposed DNA during ATAC library construction via PCR. <br />
<br />
To produce the 3’ gene expression library, barcoded, full-length pre-amplified cDNA is amplified again via PCR to generate sufficient mass for gene expression library construction. The sample is then fragmented, end-repaired, A-tailed and ligated with universal adapters. A second sample barcode is then added during the PCR step, allowing for unique library identification.<br />
<br />
= Sequencing =<br />
<br />
All libraries are qPCR'ed using KAPA qPCR library quant kit as per manufacturers protocol. The samples are loaded on the HiSeq 2500/NovaSeq 6000 based on qPCR concentrations.<br />
<br />
<br />
= Data Processing =<br />
<br />
All data is preprocessed and converted to FASTQ format. Please refer to the section [[SequencingFormats|Sequencing Format]] for details. Format of FASTQ can be converted using the script available under [[Scripts|Scripts]].<br />
<br />
Single cell 10x data is processed using cellranger pipeline and hence the above links do not apply to it.</div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=NCBISubmission&diff=18793NCBISubmission2023-08-04T13:56:32Z<p>Sgupta: </p>
<hr />
<div>= Prep Descriptions =<br />
<br />
=== Swift ChIP-Seq ===<br />
Libraries were prepared for ChIP-Seq using Swift Science’s Accel-NGS Library Preparation Kit for Illumina Platforms according to manufacturer’s directions. The swift kit makes library from 10pg-100ng of double stranded input material. Briefly, the sample undergoes a series of incubations and purifications. The sample, through multiple incubations, repairs both 5’ and 3’ termini and sequentially attaches Illumina adapter sequences to the ends of fragmented dsDNA. The multiple bead-based clean-ups are used to remove oligonucleotides and small fragments, and to change enzymatic buffer composition between steps.<br />
<br />
<br />
=== KAPA HyperPrep mRNA ===<br />
Libraries were prepared for RNA-Seq using Roche Diagnostics KAPA mRNA HyperPrep Kit, according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is enriched for polyadenylated sequences using oligo-dT magnetic bead capture. The enriched mRNA fraction is then fragmented, and first-strand cDNA is generated using random primers. '''Strand specificity is achieved''' during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification. The resulting cDNA is A-Tailed and ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR.<br />
<br />
<br />
=== KAPA RNA HyperPrep Kit with RiboErase ===<br />
Libraries were prepared for RNA-Seq using the KAPA Biosystems RNA HyperPrep Kit with RiboErase, according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is ribo-depleted by hybridization of complementary DNA oligonucleotides, followed by treatment with RNase H and DNase to remove rRNA duplexed to DNA and original DNA oligonucleotides. The enriched fraction is then fragmented with heat and magnesium, and first-strand cDNA is generated using random primers. Strand specificity is achieved during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification, and the cDNA is then A-Tailed. The final double strand cDNA is then ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR. <br />
<br />
<br />
=== TruSeq PolyA ===<br />
Libraries were prepared for RNA-Seq using Illumina’s TruSeq Stranded mRNA Library Preparation Kit according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is enriched for polyadenylated sequences using oligo dT magnetic bead capture. The enriched mRNA fraction is then fragmented, and first-strand cDNA is generated using random primers. '''Strand specificity is achieved''' during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification. The resulting cDNA is A-Tailed and ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR. <br />
<br />
<br />
=== TruSeq RiboZero ===<br />
Libraries were prepared for RNA-Seq using Illumina’s TruSeq Stranded Total RNA Library Preparation Kit according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is ribo-depleted using biotinylated, target-specific oligos combined with Ribo-Zero rRNA removal beads. The enriched fraction is then fragmented, and first-strand cDNA is generated using random primers. '''Strand specificity is achieved''' during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification. The resulting cDNA is A-Tailed and ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR. <br />
<br />
<br />
=== SMARTer V4 ===<br />
<br />
Upto 10 ng of sample was prepared using Takara’s SMART-Seq v4 Ultra Low Input RNA protocol per manufacturer’s guidelines. Briefly, RNA underwent reverse transcription via template switching and amplification, resulting in double stranded cDNA. The amount of cDNA between 100-3000 bp was calculated by Fragment Analyzer and Qubit. 150pg of the sample in range was then added to Illumina’s Nextera XT and processed according to manufacturer’s guidelines. Briefly, the cDNA underwent tagmentation, using Nextera XT’s transposase, and unique dual indexes were added by PCR amplification. Final libraries went through QC with the Fragment Analyzer and qPCR on a Roche Light Cycler 480 II. All libraries were then pooled and sequenced at single-end 40 base-pair using the Illumina HiSeq 2500. Demultiplexed sequencing data was handed over.<br />
<br />
<br />
=== 10X - Single cell (Next GEM) - 3p v3 or v3.1 ===<br />
<br />
Cells were processed using the 10X Genomics Chromium Controller with the Single Cell 3ʹ v3 Reagent Kit, according to manufacturer’s directions. Briefly, a target number of cells per library was roughly achieved by loading 1.6 times the target number of cells in suspension, along with barcoded beads and partitioning oil, into the Chromium Controller, in order to create GEMs (Gel Beads in Emulsion). The Chromium Controller combines individual cells, first strand master mix, and gel beads containing barcoded oligonucleotides into single-cell droplets for first strand cDNA synthesis, so that each cell is marked with its own unique barcode during reverse transcription. The 3’ beads contain a poly(dT) oligo that enables the production of barcoded, full-length cDNA from poly-adenylated mRNA. After first strand synthesis is complete, the emulsion is dissolved and the cDNA is pooled for bulk processing as a single sample. The sample is fragmented, end-repaired, A-tailed and ligated with universal adapters. A second sample barcode is then added during the PCR step, allowing for unique library identification. The end result is a single library representing one cell suspension, containing data for each individual cell.<br />
<br />
<br />
'''Genome core switched to v3 kit in May 2019. Some preps may have been done in v2 due to specific requests from users. Typically the lane annotation file's prep method column would indicate if v3 was used for the preps'''<br />
<br />
=== 10X - Single cell (Next GEM) - 5p v2 ===<br />
<br />
Cells were processed using the 10X Genomics Chromium Controller with the Single Cell 5ʹ v2 Reagent Kit, according to manufacturer’s directions. Briefly, a target number of cells per library was roughly achieved by loading 1.6 times the target number of cells in suspension, along with barcoded beads and partitioning oil, into the Chromium Controller, in order to create GEMs (Gel Beads in Emulsion). The Chromium Controller combines individual cells, first strand master mix, and gel beads containing barcoded oligonucleotides into single-cell droplets for first strand cDNA synthesis, so that each cell is marked with its own unique barcode during reverse transcription. The 5’ beads contain a template switching oligo that, combined with a poly(dT) primer, enables the production of barcoded, full-length cDNA from poly-adenylated mRNA. After first strand synthesis is complete, the emulsion is dissolved and the cDNA is pooled for bulk processing as a single sample. The sample is fragmented, end-repaired, A-tailed and ligated with universal adapters. A second sample barcode is then added during the PCR step, allowing for unique library identification. The end result is a single library representing one cell suspension, containing data for each individual cell.<br />
<br />
=== 10X - Single Cell (Next GEM 5’) – V(D)J ===<br />
Amplified full-length cDNA from mRNA generated using the Next GEM 5’ kit is used to amplify full-length V(D)J segments via PCR amplification with primers specific to either the TCR or BCR constant regions. Enzymatic fragmentation and size selection are used to generate variable length fragments that collectively span the V(D)J segments of the amplified TCR or BCR transcripts prior to library construction. The sample is then fragmented, end-repaired, A-tailed and ligated with universal adapters. A second sample barcode is then added during the PCR step, allowing for unique library identification.<br />
<br />
=== 10X - Single Cell (Next GEM) - Multiome – 3’ GEX and ATAC ===<br />
<br />
Nuclei were processed using the 10X Genomics Chromium Controller with the Next GEM Single Cell Multiome Reagent Kit, according to manufacturer’s directions. Briefly, nuclei suspensions are incubated in a Transposition Mix that includes a Transposase. The Transposase enters the nuclei and preferentially fragments the DNA in open regions of the chromatin. Simultaneously, adapter sequences are added to the ends of the DNA fragments. Transposed nuclei are combined with barcoded beads and partitioning oil into the Chromium Controller, in order to create GEMs (Gel Beads in Emulsion). Single Cell Multiome ATAC + GEX Gel Beads include both a poly(dT) sequence that enables production of barcoded, full-length cDNA from poly-adenylated mRNA for the gene expression library, and a Spacer sequence that enables barcode attachment to transposed DNA fragments for the ATAC library. A pre-amplification step provides template material for both downstream ATAC and gene expression library production. <br />
<br />
To produce the ATAC library, P7 and a sample index are added to pre-amplified, transposed DNA during ATAC library construction via PCR. <br />
<br />
To produce the 3’ gene expression library, barcoded, full-length pre-amplified cDNA is amplified again via PCR to generate sufficient mass for gene expression library construction. The sample is then fragmented, end-repaired, A-tailed and ligated with universal adapters. A second sample barcode is then added during the PCR step, allowing for unique library identification.<br />
<br />
= Sequencing =<br />
<br />
All libraries are qPCR'ed using KAPA qPCR library quant kit as per manufacturers protocol. The samples are loaded on the HiSeq 2500/NovaSeq 6000 based on qPCR concentrations.<br />
<br />
<br />
= Data Processing =<br />
<br />
All data is preprocessed and converted to FASTQ format. Please refer to the section [[SequencingFormats|Sequencing Format]] for details. Format of FASTQ can be converted using the script available under [[Scripts|Scripts]].<br />
<br />
Single cell 10x data is processed using cellranger pipeline and hence the above links do not apply to it.</div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=NCBISubmission&diff=18792NCBISubmission2023-08-04T13:55:55Z<p>Sgupta: /* 10X Next GEM- Multiome – 3’ GEX and ATAC */</p>
<hr />
<div>= Prep Descriptions =<br />
<br />
=== Swift ChIP-Seq ===<br />
Libraries were prepared for ChIP-Seq using Swift Science’s Accel-NGS Library Preparation Kit for Illumina Platforms according to manufacturer’s directions. The swift kit makes library from 10pg-100ng of double stranded input material. Briefly, the sample undergoes a series of incubations and purifications. The sample, through multiple incubations, repairs both 5’ and 3’ termini and sequentially attaches Illumina adapter sequences to the ends of fragmented dsDNA. The multiple bead-based clean-ups are used to remove oligonucleotides and small fragments, and to change enzymatic buffer composition between steps.<br />
<br />
<br />
=== KAPA HyperPrep mRNA ===<br />
Libraries were prepared for RNA-Seq using Roche Diagnostics KAPA mRNA HyperPrep Kit, according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is enriched for polyadenylated sequences using oligo-dT magnetic bead capture. The enriched mRNA fraction is then fragmented, and first-strand cDNA is generated using random primers. '''Strand specificity is achieved''' during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification. The resulting cDNA is A-Tailed and ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR.<br />
<br />
<br />
=== KAPA RNA HyperPrep Kit with RiboErase ===<br />
Libraries were prepared for RNA-Seq using the KAPA Biosystems RNA HyperPrep Kit with RiboErase, according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is ribo-depleted by hybridization of complementary DNA oligonucleotides, followed by treatment with RNase H and DNase to remove rRNA duplexed to DNA and original DNA oligonucleotides. The enriched fraction is then fragmented with heat and magnesium, and first-strand cDNA is generated using random primers. Strand specificity is achieved during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification, and the cDNA is then A-Tailed. The final double strand cDNA is then ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR. <br />
<br />
<br />
=== TruSeq PolyA ===<br />
Libraries were prepared for RNA-Seq using Illumina’s TruSeq Stranded mRNA Library Preparation Kit according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is enriched for polyadenylated sequences using oligo dT magnetic bead capture. The enriched mRNA fraction is then fragmented, and first-strand cDNA is generated using random primers. '''Strand specificity is achieved''' during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification. The resulting cDNA is A-Tailed and ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR. <br />
<br />
<br />
=== TruSeq RiboZero ===<br />
Libraries were prepared for RNA-Seq using Illumina’s TruSeq Stranded Total RNA Library Preparation Kit according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is ribo-depleted using biotinylated, target-specific oligos combined with Ribo-Zero rRNA removal beads. The enriched fraction is then fragmented, and first-strand cDNA is generated using random primers. '''Strand specificity is achieved''' during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification. The resulting cDNA is A-Tailed and ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR. <br />
<br />
<br />
=== SMARTer V4 ===<br />
<br />
Upto 10 ng of sample was prepared using Takara’s SMART-Seq v4 Ultra Low Input RNA protocol per manufacturer’s guidelines. Briefly, RNA underwent reverse transcription via template switching and amplification, resulting in double stranded cDNA. The amount of cDNA between 100-3000 bp was calculated by Fragment Analyzer and Qubit. 150pg of the sample in range was then added to Illumina’s Nextera XT and processed according to manufacturer’s guidelines. Briefly, the cDNA underwent tagmentation, using Nextera XT’s transposase, and unique dual indexes were added by PCR amplification. Final libraries went through QC with the Fragment Analyzer and qPCR on a Roche Light Cycler 480 II. All libraries were then pooled and sequenced at single-end 40 base-pair using the Illumina HiSeq 2500. Demultiplexed sequencing data was handed over.<br />
<br />
<br />
=== 10X - Single cell - 3p v3 or v3.1 ===<br />
<br />
Cells were processed using the 10X Genomics Chromium Controller with the Single Cell 3ʹ v3 Reagent Kit, according to manufacturer’s directions. Briefly, a target number of cells per library was roughly achieved by loading 1.6 times the target number of cells in suspension, along with barcoded beads and partitioning oil, into the Chromium Controller, in order to create GEMs (Gel Beads in Emulsion). The Chromium Controller combines individual cells, first strand master mix, and gel beads containing barcoded oligonucleotides into single-cell droplets for first strand cDNA synthesis, so that each cell is marked with its own unique barcode during reverse transcription. The 3’ beads contain a poly(dT) oligo that enables the production of barcoded, full-length cDNA from poly-adenylated mRNA. After first strand synthesis is complete, the emulsion is dissolved and the cDNA is pooled for bulk processing as a single sample. The sample is fragmented, end-repaired, A-tailed and ligated with universal adapters. A second sample barcode is then added during the PCR step, allowing for unique library identification. The end result is a single library representing one cell suspension, containing data for each individual cell.<br />
<br />
<br />
'''Genome core switched to v3 kit in May 2019. Some preps may have been done in v2 due to specific requests from users. Typically the lane annotation file's prep method column would indicate if v3 was used for the preps'''<br />
<br />
=== 10X - Single cell - 5p v2 ===<br />
<br />
Cells were processed using the 10X Genomics Chromium Controller with the Single Cell 5ʹ v2 Reagent Kit, according to manufacturer’s directions. Briefly, a target number of cells per library was roughly achieved by loading 1.6 times the target number of cells in suspension, along with barcoded beads and partitioning oil, into the Chromium Controller, in order to create GEMs (Gel Beads in Emulsion). The Chromium Controller combines individual cells, first strand master mix, and gel beads containing barcoded oligonucleotides into single-cell droplets for first strand cDNA synthesis, so that each cell is marked with its own unique barcode during reverse transcription. The 5’ beads contain a template switching oligo that, combined with a poly(dT) primer, enables the production of barcoded, full-length cDNA from poly-adenylated mRNA. After first strand synthesis is complete, the emulsion is dissolved and the cDNA is pooled for bulk processing as a single sample. The sample is fragmented, end-repaired, A-tailed and ligated with universal adapters. A second sample barcode is then added during the PCR step, allowing for unique library identification. The end result is a single library representing one cell suspension, containing data for each individual cell.<br />
<br />
=== 10X - Single Cell (Next GEM 5’) – V(D)J ===<br />
Amplified full-length cDNA from mRNA generated using the Next GEM 5’ kit is used to amplify full-length V(D)J segments via PCR amplification with primers specific to either the TCR or BCR constant regions. Enzymatic fragmentation and size selection are used to generate variable length fragments that collectively span the V(D)J segments of the amplified TCR or BCR transcripts prior to library construction. The sample is then fragmented, end-repaired, A-tailed and ligated with universal adapters. A second sample barcode is then added during the PCR step, allowing for unique library identification.<br />
<br />
=== 10X - Single Cell (Next GEM) - Multiome – 3’ GEX and ATAC ===<br />
<br />
Nuclei were processed using the 10X Genomics Chromium Controller with the Next GEM Single Cell Multiome Reagent Kit, according to manufacturer’s directions. Briefly, nuclei suspensions are incubated in a Transposition Mix that includes a Transposase. The Transposase enters the nuclei and preferentially fragments the DNA in open regions of the chromatin. Simultaneously, adapter sequences are added to the ends of the DNA fragments. Transposed nuclei are combined with barcoded beads and partitioning oil into the Chromium Controller, in order to create GEMs (Gel Beads in Emulsion). Single Cell Multiome ATAC + GEX Gel Beads include both a poly(dT) sequence that enables production of barcoded, full-length cDNA from poly-adenylated mRNA for the gene expression library, and a Spacer sequence that enables barcode attachment to transposed DNA fragments for the ATAC library. A pre-amplification step provides template material for both downstream ATAC and gene expression library production. <br />
<br />
To produce the ATAC library, P7 and a sample index are added to pre-amplified, transposed DNA during ATAC library construction via PCR. <br />
<br />
To produce the 3’ gene expression library, barcoded, full-length pre-amplified cDNA is amplified again via PCR to generate sufficient mass for gene expression library construction. The sample is then fragmented, end-repaired, A-tailed and ligated with universal adapters. A second sample barcode is then added during the PCR step, allowing for unique library identification.<br />
<br />
= Sequencing =<br />
<br />
All libraries are qPCR'ed using KAPA qPCR library quant kit as per manufacturers protocol. The samples are loaded on the HiSeq 2500/NovaSeq 6000 based on qPCR concentrations.<br />
<br />
<br />
= Data Processing =<br />
<br />
All data is preprocessed and converted to FASTQ format. Please refer to the section [[SequencingFormats|Sequencing Format]] for details. Format of FASTQ can be converted using the script available under [[Scripts|Scripts]].<br />
<br />
Single cell 10x data is processed using cellranger pipeline and hence the above links do not apply to it.</div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=NCBISubmission&diff=18791NCBISubmission2023-08-04T13:55:36Z<p>Sgupta: /* 10X Next GEM 5’ – V(D)J */</p>
<hr />
<div>= Prep Descriptions =<br />
<br />
=== Swift ChIP-Seq ===<br />
Libraries were prepared for ChIP-Seq using Swift Science’s Accel-NGS Library Preparation Kit for Illumina Platforms according to manufacturer’s directions. The swift kit makes library from 10pg-100ng of double stranded input material. Briefly, the sample undergoes a series of incubations and purifications. The sample, through multiple incubations, repairs both 5’ and 3’ termini and sequentially attaches Illumina adapter sequences to the ends of fragmented dsDNA. The multiple bead-based clean-ups are used to remove oligonucleotides and small fragments, and to change enzymatic buffer composition between steps.<br />
<br />
<br />
=== KAPA HyperPrep mRNA ===<br />
Libraries were prepared for RNA-Seq using Roche Diagnostics KAPA mRNA HyperPrep Kit, according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is enriched for polyadenylated sequences using oligo-dT magnetic bead capture. The enriched mRNA fraction is then fragmented, and first-strand cDNA is generated using random primers. '''Strand specificity is achieved''' during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification. The resulting cDNA is A-Tailed and ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR.<br />
<br />
<br />
=== KAPA RNA HyperPrep Kit with RiboErase ===<br />
Libraries were prepared for RNA-Seq using the KAPA Biosystems RNA HyperPrep Kit with RiboErase, according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is ribo-depleted by hybridization of complementary DNA oligonucleotides, followed by treatment with RNase H and DNase to remove rRNA duplexed to DNA and original DNA oligonucleotides. The enriched fraction is then fragmented with heat and magnesium, and first-strand cDNA is generated using random primers. Strand specificity is achieved during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification, and the cDNA is then A-Tailed. The final double strand cDNA is then ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR. <br />
<br />
<br />
=== TruSeq PolyA ===<br />
Libraries were prepared for RNA-Seq using Illumina’s TruSeq Stranded mRNA Library Preparation Kit according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is enriched for polyadenylated sequences using oligo dT magnetic bead capture. The enriched mRNA fraction is then fragmented, and first-strand cDNA is generated using random primers. '''Strand specificity is achieved''' during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification. The resulting cDNA is A-Tailed and ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR. <br />
<br />
<br />
=== TruSeq RiboZero ===<br />
Libraries were prepared for RNA-Seq using Illumina’s TruSeq Stranded Total RNA Library Preparation Kit according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is ribo-depleted using biotinylated, target-specific oligos combined with Ribo-Zero rRNA removal beads. The enriched fraction is then fragmented, and first-strand cDNA is generated using random primers. '''Strand specificity is achieved''' during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification. The resulting cDNA is A-Tailed and ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR. <br />
<br />
<br />
=== SMARTer V4 ===<br />
<br />
Upto 10 ng of sample was prepared using Takara’s SMART-Seq v4 Ultra Low Input RNA protocol per manufacturer’s guidelines. Briefly, RNA underwent reverse transcription via template switching and amplification, resulting in double stranded cDNA. The amount of cDNA between 100-3000 bp was calculated by Fragment Analyzer and Qubit. 150pg of the sample in range was then added to Illumina’s Nextera XT and processed according to manufacturer’s guidelines. Briefly, the cDNA underwent tagmentation, using Nextera XT’s transposase, and unique dual indexes were added by PCR amplification. Final libraries went through QC with the Fragment Analyzer and qPCR on a Roche Light Cycler 480 II. All libraries were then pooled and sequenced at single-end 40 base-pair using the Illumina HiSeq 2500. Demultiplexed sequencing data was handed over.<br />
<br />
<br />
=== 10X - Single cell - 3p v3 or v3.1 ===<br />
<br />
Cells were processed using the 10X Genomics Chromium Controller with the Single Cell 3ʹ v3 Reagent Kit, according to manufacturer’s directions. Briefly, a target number of cells per library was roughly achieved by loading 1.6 times the target number of cells in suspension, along with barcoded beads and partitioning oil, into the Chromium Controller, in order to create GEMs (Gel Beads in Emulsion). The Chromium Controller combines individual cells, first strand master mix, and gel beads containing barcoded oligonucleotides into single-cell droplets for first strand cDNA synthesis, so that each cell is marked with its own unique barcode during reverse transcription. The 3’ beads contain a poly(dT) oligo that enables the production of barcoded, full-length cDNA from poly-adenylated mRNA. After first strand synthesis is complete, the emulsion is dissolved and the cDNA is pooled for bulk processing as a single sample. The sample is fragmented, end-repaired, A-tailed and ligated with universal adapters. A second sample barcode is then added during the PCR step, allowing for unique library identification. The end result is a single library representing one cell suspension, containing data for each individual cell.<br />
<br />
<br />
'''Genome core switched to v3 kit in May 2019. Some preps may have been done in v2 due to specific requests from users. Typically the lane annotation file's prep method column would indicate if v3 was used for the preps'''<br />
<br />
=== 10X - Single cell - 5p v2 ===<br />
<br />
Cells were processed using the 10X Genomics Chromium Controller with the Single Cell 5ʹ v2 Reagent Kit, according to manufacturer’s directions. Briefly, a target number of cells per library was roughly achieved by loading 1.6 times the target number of cells in suspension, along with barcoded beads and partitioning oil, into the Chromium Controller, in order to create GEMs (Gel Beads in Emulsion). The Chromium Controller combines individual cells, first strand master mix, and gel beads containing barcoded oligonucleotides into single-cell droplets for first strand cDNA synthesis, so that each cell is marked with its own unique barcode during reverse transcription. The 5’ beads contain a template switching oligo that, combined with a poly(dT) primer, enables the production of barcoded, full-length cDNA from poly-adenylated mRNA. After first strand synthesis is complete, the emulsion is dissolved and the cDNA is pooled for bulk processing as a single sample. The sample is fragmented, end-repaired, A-tailed and ligated with universal adapters. A second sample barcode is then added during the PCR step, allowing for unique library identification. The end result is a single library representing one cell suspension, containing data for each individual cell.<br />
<br />
=== 10X - Single Cell (Next GEM 5’) – V(D)J ===<br />
Amplified full-length cDNA from mRNA generated using the Next GEM 5’ kit is used to amplify full-length V(D)J segments via PCR amplification with primers specific to either the TCR or BCR constant regions. Enzymatic fragmentation and size selection are used to generate variable length fragments that collectively span the V(D)J segments of the amplified TCR or BCR transcripts prior to library construction. The sample is then fragmented, end-repaired, A-tailed and ligated with universal adapters. A second sample barcode is then added during the PCR step, allowing for unique library identification.<br />
<br />
=== 10X Next GEM- Multiome – 3’ GEX and ATAC ===<br />
<br />
Nuclei were processed using the 10X Genomics Chromium Controller with the Next GEM Single Cell Multiome Reagent Kit, according to manufacturer’s directions. Briefly, nuclei suspensions are incubated in a Transposition Mix that includes a Transposase. The Transposase enters the nuclei and preferentially fragments the DNA in open regions of the chromatin. Simultaneously, adapter sequences are added to the ends of the DNA fragments. Transposed nuclei are combined with barcoded beads and partitioning oil into the Chromium Controller, in order to create GEMs (Gel Beads in Emulsion). Single Cell Multiome ATAC + GEX Gel Beads include both a poly(dT) sequence that enables production of barcoded, full-length cDNA from poly-adenylated mRNA for the gene expression library, and a Spacer sequence that enables barcode attachment to transposed DNA fragments for the ATAC library. A pre-amplification step provides template material for both downstream ATAC and gene expression library production. <br />
<br />
To produce the ATAC library, P7 and a sample index are added to pre-amplified, transposed DNA during ATAC library construction via PCR. <br />
<br />
To produce the 3’ gene expression library, barcoded, full-length pre-amplified cDNA is amplified again via PCR to generate sufficient mass for gene expression library construction. The sample is then fragmented, end-repaired, A-tailed and ligated with universal adapters. A second sample barcode is then added during the PCR step, allowing for unique library identification.<br />
<br />
<br />
= Sequencing =<br />
<br />
All libraries are qPCR'ed using KAPA qPCR library quant kit as per manufacturers protocol. The samples are loaded on the HiSeq 2500/NovaSeq 6000 based on qPCR concentrations.<br />
<br />
<br />
= Data Processing =<br />
<br />
All data is preprocessed and converted to FASTQ format. Please refer to the section [[SequencingFormats|Sequencing Format]] for details. Format of FASTQ can be converted using the script available under [[Scripts|Scripts]].<br />
<br />
Single cell 10x data is processed using cellranger pipeline and hence the above links do not apply to it.</div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=NCBISubmission&diff=18790NCBISubmission2023-08-04T13:54:46Z<p>Sgupta: </p>
<hr />
<div>= Prep Descriptions =<br />
<br />
=== Swift ChIP-Seq ===<br />
Libraries were prepared for ChIP-Seq using Swift Science’s Accel-NGS Library Preparation Kit for Illumina Platforms according to manufacturer’s directions. The swift kit makes library from 10pg-100ng of double stranded input material. Briefly, the sample undergoes a series of incubations and purifications. The sample, through multiple incubations, repairs both 5’ and 3’ termini and sequentially attaches Illumina adapter sequences to the ends of fragmented dsDNA. The multiple bead-based clean-ups are used to remove oligonucleotides and small fragments, and to change enzymatic buffer composition between steps.<br />
<br />
<br />
=== KAPA HyperPrep mRNA ===<br />
Libraries were prepared for RNA-Seq using Roche Diagnostics KAPA mRNA HyperPrep Kit, according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is enriched for polyadenylated sequences using oligo-dT magnetic bead capture. The enriched mRNA fraction is then fragmented, and first-strand cDNA is generated using random primers. '''Strand specificity is achieved''' during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification. The resulting cDNA is A-Tailed and ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR.<br />
<br />
<br />
=== KAPA RNA HyperPrep Kit with RiboErase ===<br />
Libraries were prepared for RNA-Seq using the KAPA Biosystems RNA HyperPrep Kit with RiboErase, according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is ribo-depleted by hybridization of complementary DNA oligonucleotides, followed by treatment with RNase H and DNase to remove rRNA duplexed to DNA and original DNA oligonucleotides. The enriched fraction is then fragmented with heat and magnesium, and first-strand cDNA is generated using random primers. Strand specificity is achieved during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification, and the cDNA is then A-Tailed. The final double strand cDNA is then ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR. <br />
<br />
<br />
=== TruSeq PolyA ===<br />
Libraries were prepared for RNA-Seq using Illumina’s TruSeq Stranded mRNA Library Preparation Kit according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is enriched for polyadenylated sequences using oligo dT magnetic bead capture. The enriched mRNA fraction is then fragmented, and first-strand cDNA is generated using random primers. '''Strand specificity is achieved''' during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification. The resulting cDNA is A-Tailed and ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR. <br />
<br />
<br />
=== TruSeq RiboZero ===<br />
Libraries were prepared for RNA-Seq using Illumina’s TruSeq Stranded Total RNA Library Preparation Kit according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is ribo-depleted using biotinylated, target-specific oligos combined with Ribo-Zero rRNA removal beads. The enriched fraction is then fragmented, and first-strand cDNA is generated using random primers. '''Strand specificity is achieved''' during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification. The resulting cDNA is A-Tailed and ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR. <br />
<br />
<br />
=== SMARTer V4 ===<br />
<br />
Upto 10 ng of sample was prepared using Takara’s SMART-Seq v4 Ultra Low Input RNA protocol per manufacturer’s guidelines. Briefly, RNA underwent reverse transcription via template switching and amplification, resulting in double stranded cDNA. The amount of cDNA between 100-3000 bp was calculated by Fragment Analyzer and Qubit. 150pg of the sample in range was then added to Illumina’s Nextera XT and processed according to manufacturer’s guidelines. Briefly, the cDNA underwent tagmentation, using Nextera XT’s transposase, and unique dual indexes were added by PCR amplification. Final libraries went through QC with the Fragment Analyzer and qPCR on a Roche Light Cycler 480 II. All libraries were then pooled and sequenced at single-end 40 base-pair using the Illumina HiSeq 2500. Demultiplexed sequencing data was handed over.<br />
<br />
<br />
=== 10X - Single cell - 3p v3 or v3.1 ===<br />
<br />
Cells were processed using the 10X Genomics Chromium Controller with the Single Cell 3ʹ v3 Reagent Kit, according to manufacturer’s directions. Briefly, a target number of cells per library was roughly achieved by loading 1.6 times the target number of cells in suspension, along with barcoded beads and partitioning oil, into the Chromium Controller, in order to create GEMs (Gel Beads in Emulsion). The Chromium Controller combines individual cells, first strand master mix, and gel beads containing barcoded oligonucleotides into single-cell droplets for first strand cDNA synthesis, so that each cell is marked with its own unique barcode during reverse transcription. The 3’ beads contain a poly(dT) oligo that enables the production of barcoded, full-length cDNA from poly-adenylated mRNA. After first strand synthesis is complete, the emulsion is dissolved and the cDNA is pooled for bulk processing as a single sample. The sample is fragmented, end-repaired, A-tailed and ligated with universal adapters. A second sample barcode is then added during the PCR step, allowing for unique library identification. The end result is a single library representing one cell suspension, containing data for each individual cell.<br />
<br />
<br />
'''Genome core switched to v3 kit in May 2019. Some preps may have been done in v2 due to specific requests from users. Typically the lane annotation file's prep method column would indicate if v3 was used for the preps'''<br />
<br />
=== 10X - Single cell - 5p v2 ===<br />
<br />
Cells were processed using the 10X Genomics Chromium Controller with the Single Cell 5ʹ v2 Reagent Kit, according to manufacturer’s directions. Briefly, a target number of cells per library was roughly achieved by loading 1.6 times the target number of cells in suspension, along with barcoded beads and partitioning oil, into the Chromium Controller, in order to create GEMs (Gel Beads in Emulsion). The Chromium Controller combines individual cells, first strand master mix, and gel beads containing barcoded oligonucleotides into single-cell droplets for first strand cDNA synthesis, so that each cell is marked with its own unique barcode during reverse transcription. The 5’ beads contain a template switching oligo that, combined with a poly(dT) primer, enables the production of barcoded, full-length cDNA from poly-adenylated mRNA. After first strand synthesis is complete, the emulsion is dissolved and the cDNA is pooled for bulk processing as a single sample. The sample is fragmented, end-repaired, A-tailed and ligated with universal adapters. A second sample barcode is then added during the PCR step, allowing for unique library identification. The end result is a single library representing one cell suspension, containing data for each individual cell.<br />
<br />
=== 10X Next GEM 5’ – V(D)J ===<br />
Amplified full-length cDNA from mRNA generated using the Next GEM 5’ kit is used to amplify full-length V(D)J segments via PCR amplification with primers specific to either the TCR or BCR constant regions. Enzymatic fragmentation and size selection are used to generate variable length fragments that collectively span the V(D)J segments of the amplified TCR or BCR transcripts prior to library construction. The sample is then fragmented, end-repaired, A-tailed and ligated with universal adapters. A second sample barcode is then added during the PCR step, allowing for unique library identification.<br />
<br />
=== 10X Next GEM- Multiome – 3’ GEX and ATAC ===<br />
<br />
Nuclei were processed using the 10X Genomics Chromium Controller with the Next GEM Single Cell Multiome Reagent Kit, according to manufacturer’s directions. Briefly, nuclei suspensions are incubated in a Transposition Mix that includes a Transposase. The Transposase enters the nuclei and preferentially fragments the DNA in open regions of the chromatin. Simultaneously, adapter sequences are added to the ends of the DNA fragments. Transposed nuclei are combined with barcoded beads and partitioning oil into the Chromium Controller, in order to create GEMs (Gel Beads in Emulsion). Single Cell Multiome ATAC + GEX Gel Beads include both a poly(dT) sequence that enables production of barcoded, full-length cDNA from poly-adenylated mRNA for the gene expression library, and a Spacer sequence that enables barcode attachment to transposed DNA fragments for the ATAC library. A pre-amplification step provides template material for both downstream ATAC and gene expression library production. <br />
<br />
To produce the ATAC library, P7 and a sample index are added to pre-amplified, transposed DNA during ATAC library construction via PCR. <br />
<br />
To produce the 3’ gene expression library, barcoded, full-length pre-amplified cDNA is amplified again via PCR to generate sufficient mass for gene expression library construction. The sample is then fragmented, end-repaired, A-tailed and ligated with universal adapters. A second sample barcode is then added during the PCR step, allowing for unique library identification.<br />
<br />
<br />
= Sequencing =<br />
<br />
All libraries are qPCR'ed using KAPA qPCR library quant kit as per manufacturers protocol. The samples are loaded on the HiSeq 2500/NovaSeq 6000 based on qPCR concentrations.<br />
<br />
<br />
= Data Processing =<br />
<br />
All data is preprocessed and converted to FASTQ format. Please refer to the section [[SequencingFormats|Sequencing Format]] for details. Format of FASTQ can be converted using the script available under [[Scripts|Scripts]].<br />
<br />
Single cell 10x data is processed using cellranger pipeline and hence the above links do not apply to it.</div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=NCBISubmission&diff=18789NCBISubmission2023-08-04T13:39:38Z<p>Sgupta: </p>
<hr />
<div>= Prep Descriptions =<br />
<br />
=== Swift ChIP-Seq ===<br />
Libraries were prepared for ChIP-Seq using Swift Science’s Accel-NGS Library Preparation Kit for Illumina Platforms according to manufacturer’s directions. The swift kit makes library from 10pg-100ng of double stranded input material. Briefly, the sample undergoes a series of incubations and purifications. The sample, through multiple incubations, repairs both 5’ and 3’ termini and sequentially attaches Illumina adapter sequences to the ends of fragmented dsDNA. The multiple bead-based clean-ups are used to remove oligonucleotides and small fragments, and to change enzymatic buffer composition between steps.<br />
<br />
<br />
=== KAPA HyperPrep mRNA ===<br />
Libraries were prepared for RNA-Seq using Roche Diagnostics KAPA mRNA HyperPrep Kit, according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is enriched for polyadenylated sequences using oligo-dT magnetic bead capture. The enriched mRNA fraction is then fragmented, and first-strand cDNA is generated using random primers. '''Strand specificity is achieved''' during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification. The resulting cDNA is A-Tailed and ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR.<br />
<br />
<br />
=== KAPA RNA HyperPrep Kit with RiboErase ===<br />
Libraries were prepared for RNA-Seq using the KAPA Biosystems RNA HyperPrep Kit with RiboErase, according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is ribo-depleted by hybridization of complementary DNA oligonucleotides, followed by treatment with RNase H and DNase to remove rRNA duplexed to DNA and original DNA oligonucleotides. The enriched fraction is then fragmented with heat and magnesium, and first-strand cDNA is generated using random primers. Strand specificity is achieved during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification, and the cDNA is then A-Tailed. The final double strand cDNA is then ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR. <br />
<br />
<br />
=== TruSeq PolyA ===<br />
Libraries were prepared for RNA-Seq using Illumina’s TruSeq Stranded mRNA Library Preparation Kit according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is enriched for polyadenylated sequences using oligo dT magnetic bead capture. The enriched mRNA fraction is then fragmented, and first-strand cDNA is generated using random primers. '''Strand specificity is achieved''' during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification. The resulting cDNA is A-Tailed and ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR. <br />
<br />
<br />
=== TruSeq RiboZero ===<br />
Libraries were prepared for RNA-Seq using Illumina’s TruSeq Stranded Total RNA Library Preparation Kit according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is ribo-depleted using biotinylated, target-specific oligos combined with Ribo-Zero rRNA removal beads. The enriched fraction is then fragmented, and first-strand cDNA is generated using random primers. '''Strand specificity is achieved''' during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification. The resulting cDNA is A-Tailed and ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR. <br />
<br />
<br />
=== SMARTer V4 ===<br />
<br />
Upto 10 ng of sample was prepared using Takara’s SMART-Seq v4 Ultra Low Input RNA protocol per manufacturer’s guidelines. Briefly, RNA underwent reverse transcription via template switching and amplification, resulting in double stranded cDNA. The amount of cDNA between 100-3000 bp was calculated by Fragment Analyzer and Qubit. 150pg of the sample in range was then added to Illumina’s Nextera XT and processed according to manufacturer’s guidelines. Briefly, the cDNA underwent tagmentation, using Nextera XT’s transposase, and unique dual indexes were added by PCR amplification. Final libraries went through QC with the Fragment Analyzer and qPCR on a Roche Light Cycler 480 II. All libraries were then pooled and sequenced at single-end 40 base-pair using the Illumina HiSeq 2500. Demultiplexed sequencing data was handed over.<br />
<br />
<br />
=== 10X - Single cell - 3p ===<br />
<br />
Cells were processed using the 10X Genomics Chromium Controller with the Single Cell 3ʹ v3 Reagent Kit, according to manufacturer’s directions. Briefly, a target number of cells per library was roughly achieved by loading 1.6 times the target number of cells in suspension, along with barcoded beads and partitioning oil, into the Chromium Controller, in order to create GEMs (Gel Beads in Emulsion). The Chromium Controller combines individual cells, first strand master mix, and gel beads containing barcoded oligonucleotides into single-cell droplets for first strand cDNA synthesis, so that each cell is marked with its own unique barcode during reverse transcription. After first strand synthesis is complete, the emulsion is dissolved and the cDNA is pooled for bulk processing as a single sample. The sample is fragmented, end-repaired, A-tailed and ligated with universal adapters. A second sample barcode is then added during the PCR step, allowing for unique library identification. The end result is a single library representing one cell suspension, containing data for each individual cell.<br />
<br />
<br />
'''Genome core switched to v3 kit in May 2019. Some preps may have been done in v2 due to specific requests from users. Typically the lane annotation file's prep method column would indicate if v3 was used for the preps'''<br />
<br />
<br />
= Sequencing =<br />
<br />
All libraries are qPCR'ed using KAPA qPCR library quant kit as per manufacturers protocol. The samples are loaded on the HiSeq 2500/NovaSeq 6000 based on qPCR concentrations.<br />
<br />
<br />
= Data Processing =<br />
<br />
All data is preprocessed and converted to FASTQ format. Please refer to the section [[SequencingFormats|Sequencing Format]] for details. Format of FASTQ can be converted using the script available under [[Scripts|Scripts]].<br />
<br />
Single cell 10x data is processed using cellranger pipeline and hence the above links do not apply to it.</div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18788Pricing2023-07-18T16:31:07Z<p>Sgupta: /* Single Cell (10X and others) */</p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,850<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,245<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,620<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,510<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,920<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,730<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$4,065<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$5,200<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,480<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,750<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 50 Single End<br />
|rowspan="2"|1 lane<br />
|$3,780<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,400<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v2 70 Single End or 30x30 Paired End|Flowcell|$1,320| 10 million reads}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,430| 20 million reads}}<br />
{{PricingRow|MiSeq v2 300 Single End or 150x150 Paired End|Flowcell|$1,595| 10 million reads}}<br />
{{PricingRow|MiSeq v2 500 Single End or 250x250 Paired End|Flowcell|$1,760| 10 million reads}}<br />
{{PricingLastRow|MiSeq v3 600 Single End or 300x300 Paired End|Flowcell|$2,200| 20 million reads}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
=== Standard (Manual) ===<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
=== Highthroughput (96 well Plate Based) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep (IDT xGen RNA)<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3" width=50%| Samples should be pre-aliquoted (in Eppendorf twin.tec semi-skirted 96 well plate), normalized (100 and 500 ng total), in a volume of 50 ul. <br />
Intake QC or quantification only by special arrangement at an additional charge. please inquire if needed.<br />
<br />
Libraries are pooled by FA quantification, expect variation in read balancing. <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
= Single Cell (10X and others) =<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ GEX|sample|$2560|}}<br />
{{PricingRow|10X Single Cell 5’ GEX|sample|$2560|}}<br />
{{PricingRow|10X VDJ Add-on|sample|$230|Can be added onto the 10X 5' GEX Only}}<br />
{{PricingRow|10X ADT/HTO/CellPlex Add-on|sample|$140|}}<br />
{{PricingRow|10X Multiome Assay (ATAC + 3')|sample|$4200|}}<br />
{{PricingRow|10X Flex (Fixed Cell)|sample|$2800|Human and Mouse Only}}<br />
{{PricingRow|Plexwell Rapid Single Cell - one 96 well plate|96 well plate|$5060|1 cell per well}}<br />
{{PricingLastRow|Plexwell Rapid Single Cell - 1 of 4 96 well plates|96 well plate|$3800|1 cell per well}}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= RNA Isolation =<br />
{{PricingHeader}}<br />
{{PricingRow|[http://genomecore.wi.mit.edu/index.php/rnaextraction RNA-miRNeasy Total RNA Isolation]|sample|$100|}}<br />
{{PricingLastRow|[http://genomecore.wi.mit.edu/index.php/rnaextraction RNA - MagMax mirVana RNA Isolation]|sample|$30|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
<br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18787Pricing2023-07-18T16:29:07Z<p>Sgupta: /* Single Cell (10X and others) */</p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,850<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,245<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,620<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,510<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,920<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,730<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$4,065<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$5,200<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,480<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,750<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 50 Single End<br />
|rowspan="2"|1 lane<br />
|$3,780<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,400<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v2 70 Single End or 30x30 Paired End|Flowcell|$1,320| 10 million reads}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,430| 20 million reads}}<br />
{{PricingRow|MiSeq v2 300 Single End or 150x150 Paired End|Flowcell|$1,595| 10 million reads}}<br />
{{PricingRow|MiSeq v2 500 Single End or 250x250 Paired End|Flowcell|$1,760| 10 million reads}}<br />
{{PricingLastRow|MiSeq v3 600 Single End or 300x300 Paired End|Flowcell|$2,200| 20 million reads}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
=== Standard (Manual) ===<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
=== Highthroughput (96 well Plate Based) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep (IDT xGen RNA)<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3" width=50%| Samples should be pre-aliquoted (in Eppendorf twin.tec semi-skirted 96 well plate), normalized (100 and 500 ng total), in a volume of 50 ul. <br />
Intake QC or quantification only by special arrangement at an additional charge. please inquire if needed.<br />
<br />
Libraries are pooled by FA quantification, expect variation in read balancing. <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
= Single Cell (10X and others) =<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ GEX|sample|$2560|}}<br />
{{PricingRow|10X Single Cell 5’ GEX|sample|$2560|}}<br />
{{PricingRow|10X VDJ Add-on|sample|$230|Can be added onto the 10X 5' GEX Only}}<br />
{{PricingRow|10X ADT/HTO/CellPlex Add-on|sample|$140|}}<br />
{{PricingRow|10X Multiome Assay (ATAC + 3')|sample|$4200|}}<br />
{{PricingRow|10X Flex (Fixed Cell)|sample|$2800|}}<br />
{{PricingRow|Plexwell Rapid Single Cell - one 96 well plate|96 well plate|$5060|1 cell per well}}<br />
{{PricingLastRow|Plexwell Rapid Single Cell - 1 of 4 96 well plates|96 well plate|$3800|1 cell per well}}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= RNA Isolation =<br />
{{PricingHeader}}<br />
{{PricingRow|[http://genomecore.wi.mit.edu/index.php/rnaextraction RNA-miRNeasy Total RNA Isolation]|sample|$100|}}<br />
{{PricingLastRow|[http://genomecore.wi.mit.edu/index.php/rnaextraction RNA - MagMax mirVana RNA Isolation]|sample|$30|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
<br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18786Pricing2023-07-18T16:26:36Z<p>Sgupta: /* Single Cell (10X and others) */</p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,850<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,245<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,620<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,510<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,920<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,730<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$4,065<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$5,200<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,480<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,750<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 50 Single End<br />
|rowspan="2"|1 lane<br />
|$3,780<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,400<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v2 70 Single End or 30x30 Paired End|Flowcell|$1,320| 10 million reads}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,430| 20 million reads}}<br />
{{PricingRow|MiSeq v2 300 Single End or 150x150 Paired End|Flowcell|$1,595| 10 million reads}}<br />
{{PricingRow|MiSeq v2 500 Single End or 250x250 Paired End|Flowcell|$1,760| 10 million reads}}<br />
{{PricingLastRow|MiSeq v3 600 Single End or 300x300 Paired End|Flowcell|$2,200| 20 million reads}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
=== Standard (Manual) ===<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
=== Highthroughput (96 well Plate Based) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep (IDT xGen RNA)<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3" width=50%| Samples should be pre-aliquoted (in Eppendorf twin.tec semi-skirted 96 well plate), normalized (100 and 500 ng total), in a volume of 50 ul. <br />
Intake QC or quantification only by special arrangement at an additional charge. please inquire if needed.<br />
<br />
Libraries are pooled by FA quantification, expect variation in read balancing. <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
= Single Cell (10X and others) =<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ gene expression|sample|$2560|}}<br />
{{PricingRow|10X Single Cell 5’ gene expression|sample|$2560|}}<br />
{{PricingRow|10X VDJ Add-on|sample|$230|Can be added onto the 10X 5' GEX Only}}<br />
{{PricingRow|10X ADT/HTO/CellPlex Add-on|sample|$140|}}<br />
{{PricingRow|10X Multiome Assay (ATAC + 3')|sample|$4200|}}<br />
{{PricingRow|10X Flex (Fixed Cell)|sample|$2800|}}<br />
{{PricingRow|Plexwell Rapid Single Cell - one 96 well plate|96 well plate|$5060|1 cell per well}}<br />
{{PricingLastRow|Plexwell Rapid Single Cell - 1 of 4 96 well plates|96 well plate|$3800|1 cell per well}}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= RNA Isolation =<br />
{{PricingHeader}}<br />
{{PricingRow|[http://genomecore.wi.mit.edu/index.php/rnaextraction RNA-miRNeasy Total RNA Isolation]|sample|$100|}}<br />
{{PricingLastRow|[http://genomecore.wi.mit.edu/index.php/rnaextraction RNA - MagMax mirVana RNA Isolation]|sample|$30|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
<br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18785Pricing2023-07-18T16:24:47Z<p>Sgupta: /* Single Cell (10X and others) */</p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,850<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,245<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,620<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,510<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,920<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,730<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$4,065<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$5,200<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,480<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,750<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 50 Single End<br />
|rowspan="2"|1 lane<br />
|$3,780<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,400<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v2 70 Single End or 30x30 Paired End|Flowcell|$1,320| 10 million reads}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,430| 20 million reads}}<br />
{{PricingRow|MiSeq v2 300 Single End or 150x150 Paired End|Flowcell|$1,595| 10 million reads}}<br />
{{PricingRow|MiSeq v2 500 Single End or 250x250 Paired End|Flowcell|$1,760| 10 million reads}}<br />
{{PricingLastRow|MiSeq v3 600 Single End or 300x300 Paired End|Flowcell|$2,200| 20 million reads}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
=== Standard (Manual) ===<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
=== Highthroughput (96 well Plate Based) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep (IDT xGen RNA)<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3" width=50%| Samples should be pre-aliquoted (in Eppendorf twin.tec semi-skirted 96 well plate), normalized (100 and 500 ng total), in a volume of 50 ul. <br />
Intake QC or quantification only by special arrangement at an additional charge. please inquire if needed.<br />
<br />
Libraries are pooled by FA quantification, expect variation in read balancing. <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
= Single Cell (10X and others) =<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ gene expression|sample|$2560|}}<br />
{{PricingRow|10X Single Cell 5’ gene expression|sample|$2560|}}<br />
{{PricingRow|10X VDJ Add-on|sample|$230|}}<br />
{{PricingRow|10X ADT/HTO/CellPlex Add-on|sample|$140|}}<br />
{{PricingRow|10X Multiome Assay (ATAC + 3')|sample|$4200|}}<br />
{{PricingRow|10X Flex (Fixed Cell)|sample|$2800|}}<br />
{{PricingRow|Plexwell Rapid Single Cell - one 96 well plate|96 well plate|$5060|1 cell per well}}<br />
{{PricingLastRow|Plexwell Rapid Single Cell - 1 of 4 96 well plates|96 well plate|$3800|1 cell per well}}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= RNA Isolation =<br />
{{PricingHeader}}<br />
{{PricingRow|[http://genomecore.wi.mit.edu/index.php/rnaextraction RNA-miRNeasy Total RNA Isolation]|sample|$100|}}<br />
{{PricingLastRow|[http://genomecore.wi.mit.edu/index.php/rnaextraction RNA - MagMax mirVana RNA Isolation]|sample|$30|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
<br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18784Pricing2023-07-18T16:17:53Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,850<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,245<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,620<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,510<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,920<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,730<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$4,065<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$5,200<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,480<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,750<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 50 Single End<br />
|rowspan="2"|1 lane<br />
|$3,780<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,400<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v2 70 Single End or 30x30 Paired End|Flowcell|$1,320| 10 million reads}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,430| 20 million reads}}<br />
{{PricingRow|MiSeq v2 300 Single End or 150x150 Paired End|Flowcell|$1,595| 10 million reads}}<br />
{{PricingRow|MiSeq v2 500 Single End or 250x250 Paired End|Flowcell|$1,760| 10 million reads}}<br />
{{PricingLastRow|MiSeq v3 600 Single End or 300x300 Paired End|Flowcell|$2,200| 20 million reads}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
=== Standard (Manual) ===<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
=== Highthroughput (96 well Plate Based) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep (IDT xGen RNA)<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3" width=50%| Samples should be pre-aliquoted (in Eppendorf twin.tec semi-skirted 96 well plate), normalized (100 and 500 ng total), in a volume of 50 ul. <br />
Intake QC or quantification only by special arrangement at an additional charge. please inquire if needed.<br />
<br />
Libraries are pooled by FA quantification, expect variation in read balancing. <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
= Single Cell (10X and others) =<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ gene expression|sample|$2560|}}<br />
{{PricingRow|10X Single Cell 5’ gene expression|sample|$2560|}}<br />
{{PricingRow|10X Single Cell 5' VDJ|sample|$2,790|}}<br />
{{PricingRow|10X ADT/HTO/CellPlex Add-on|sample|$140|}}<br />
{{PricingRow|10X Multiome Assay (ATAC + 3')|sample|$4200|}}<br />
{{PricingRow|10X Flex (Fixed Cell)|sample|$2800|}}<br />
{{PricingRow|Plexwell Rapid Single Cell - one 96 well plate|96 well plate|$5060|1 cell per well}}<br />
{{PricingLastRow|Plexwell Rapid Single Cell - 1 of 4 96 well plates|96 well plate|$3800|1 cell per well}}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= RNA Isolation =<br />
{{PricingHeader}}<br />
{{PricingRow|[http://genomecore.wi.mit.edu/index.php/rnaextraction RNA-miRNeasy Total RNA Isolation]|sample|$100|}}<br />
{{PricingLastRow|[http://genomecore.wi.mit.edu/index.php/rnaextraction RNA - MagMax mirVana RNA Isolation]|sample|$30|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
<br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18783Pricing2023-07-17T16:29:01Z<p>Sgupta: /* 10X Chromium Prep (Single Cell) */</p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,850<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,245<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,620<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,510<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,920<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,730<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$4,065<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$5,200<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,480<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,750<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 50 Single End<br />
|rowspan="2"|1 lane<br />
|$3,780<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,400<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v2 70 Single End or 30x30 Paired End|Flowcell|$1,320| 10 million reads}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,430| 20 million reads}}<br />
{{PricingRow|MiSeq v2 300 Single End or 150x150 Paired End|Flowcell|$1,595| 10 million reads}}<br />
{{PricingRow|MiSeq v2 500 Single End or 250x250 Paired End|Flowcell|$1,760| 10 million reads}}<br />
{{PricingLastRow|MiSeq v3 600 Single End or 300x300 Paired End|Flowcell|$2,200| 20 million reads}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
=== Standard (Manual) ===<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
=== Highthroughput (96 well Plate Based) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep (IDT xGen RNA)<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3" width=50%| Samples should be pre-aliquoted (in Eppendorf twin.tec semi-skirted 96 well plate), normalized (100 and 500 ng total), in a volume of 50 ul. <br />
Intake QC or quantification only by special arrangement at an additional charge. please inquire if needed.<br />
<br />
Libraries are pooled by FA quantification, expect variation in read balancing. <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
= Single Cell (10X and others) =<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2560|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2560|}}<br />
{{PricingRow|10X 5' VDJ Add-On|sample|$210|}}<br />
{{PricingRow|10X ADT/HTO/CellPlex Add-on|sample|$105|}}<br />
{{PricingRow|10X Multiome Assay (ATAC + 3')|sample|$4200|}}<br />
{{PricingRow|10X Flex (Fixed Cell)|sample|$2800|}}<br />
{{PricingRow|Plexwell Rapid Single Cell - one 96 well plate|96 well plate|$5060|1 cell per well}}<br />
{{PricingLastRow|Plexwell Rapid Single Cell - 1 of 4 96 well plates|96 well plate|$3800|1 cell per well}}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= RNA Isolation =<br />
{{PricingHeader}}<br />
{{PricingRow|[http://genomecore.wi.mit.edu/index.php/rnaextraction RNA-miRNeasy Total RNA Isolation]|sample|$100|}}<br />
{{PricingLastRow|[http://genomecore.wi.mit.edu/index.php/rnaextraction RNA - MagMax mirVana RNA Isolation]|sample|$30|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
<br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18782Pricing2023-07-17T16:28:35Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,850<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,245<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,620<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,510<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,920<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,730<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$4,065<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$5,200<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,480<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,750<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 50 Single End<br />
|rowspan="2"|1 lane<br />
|$3,780<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,400<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v2 70 Single End or 30x30 Paired End|Flowcell|$1,320| 10 million reads}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,430| 20 million reads}}<br />
{{PricingRow|MiSeq v2 300 Single End or 150x150 Paired End|Flowcell|$1,595| 10 million reads}}<br />
{{PricingRow|MiSeq v2 500 Single End or 250x250 Paired End|Flowcell|$1,760| 10 million reads}}<br />
{{PricingLastRow|MiSeq v3 600 Single End or 300x300 Paired End|Flowcell|$2,200| 20 million reads}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
=== Standard (Manual) ===<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
=== Highthroughput (96 well Plate Based) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep (IDT xGen RNA)<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3" width=50%| Samples should be pre-aliquoted (in Eppendorf twin.tec semi-skirted 96 well plate), normalized (100 and 500 ng total), in a volume of 50 ul. <br />
Intake QC or quantification only by special arrangement at an additional charge. please inquire if needed.<br />
<br />
Libraries are pooled by FA quantification, expect variation in read balancing. <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
= 10X Chromium Prep (Single Cell) =<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2560|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2560|}}<br />
{{PricingRow|10X 5' VDJ Add-On|sample|$210|}}<br />
{{PricingRow|10X ADT/HTO/CellPlex Add-on|sample|$105|}}<br />
{{PricingRow|10X Multiome Assay (ATAC + 3')|sample|$4200|}}<br />
{{PricingRow|10X Flex (Fixed Cell)|sample|$2800|}}<br />
{{PricingRow|Plexwell Rapid Single Cell - one 96 well plate|96 well plate|$5060|1 cell per well}}<br />
{{PricingLastRow|Plexwell Rapid Single Cell - 1 of 4 96 well plates|96 well plate|$3800|1 cell per well}}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= RNA Isolation =<br />
{{PricingHeader}}<br />
{{PricingRow|[http://genomecore.wi.mit.edu/index.php/rnaextraction RNA-miRNeasy Total RNA Isolation]|sample|$100|}}<br />
{{PricingLastRow|[http://genomecore.wi.mit.edu/index.php/rnaextraction RNA - MagMax mirVana RNA Isolation]|sample|$30|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
<br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=NCBISubmission&diff=18781NCBISubmission2023-07-13T18:54:02Z<p>Sgupta: </p>
<hr />
<div>= Prep Descriptions =<br />
<br />
=== Swift ChIP-Seq ===<br />
Libraries were prepared for ChIP-Seq using Swift Science’s Accel-NGS Library Preparation Kit for Illumina Platforms according to manufacturer’s directions. The swift kit makes library from 10pg-100ng of double stranded input material. Briefly, the sample undergoes a series of incubations and purifications. The sample, through multiple incubations, repairs both 5’ and 3’ termini and sequentially attaches Illumina adapter sequences to the ends of fragmented dsDNA. The multiple bead-based clean-ups are used to remove oligonucleotides and small fragments, and to change enzymatic buffer composition between steps.<br />
<br />
<br />
=== KAPA HyperPrep mRNA ===<br />
Libraries were prepared for RNA-Seq using Roche Diagnostics KAPA mRNA HyperPrep Kit, according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is enriched for polyadenylated sequences using oligo-dT magnetic bead capture. The enriched mRNA fraction is then fragmented, and first-strand cDNA is generated using random primers. '''Strand specificity is achieved''' during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification. The resulting cDNA is A-Tailed and ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR.<br />
<br />
<br />
=== KAPA RNA HyperPrep Kit with RiboErase ===<br />
Libraries were prepared for RNA-Seq using the KAPA Biosystems RNA HyperPrep Kit with RiboErase, according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is ribo-depleted by hybridization of complementary DNA oligonucleotides, followed by treatment with RNase H and DNase to remove rRNA duplexed to DNA and original DNA oligonucleotides. The enriched fraction is then fragmented with heat and magnesium, and first-strand cDNA is generated using random primers. Strand specificity is achieved during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification, and the cDNA is then A-Tailed. The final double strand cDNA is then ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR. <br />
<br />
<br />
=== TruSeq PolyA ===<br />
Libraries were prepared for RNA-Seq using Illumina’s TruSeq Stranded mRNA Library Preparation Kit according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is enriched for polyadenylated sequences using oligo dT magnetic bead capture. The enriched mRNA fraction is then fragmented, and first-strand cDNA is generated using random primers. '''Strand specificity is achieved''' during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification. The resulting cDNA is A-Tailed and ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR. <br />
<br />
<br />
=== TruSeq RiboZero ===<br />
Libraries were prepared for RNA-Seq using Illumina’s TruSeq Stranded Total RNA Library Preparation Kit according to manufacturer’s directions. Briefly, total RNA (0.1-1 ug) is ribo-depleted using biotinylated, target-specific oligos combined with Ribo-Zero rRNA removal beads. The enriched fraction is then fragmented, and first-strand cDNA is generated using random primers. '''Strand specificity is achieved''' during second-strand cDNA synthesis by replacing dTTP with dUTP, which quenches the second strand during amplification. The resulting cDNA is A-Tailed and ligated with indexed adapters. Finally, the library is amplified using a DNA Polymerase which cannot incorporate past dUTPs, effectively quenching the second strand during PCR. <br />
<br />
<br />
=== SMARTer V4 ===<br />
<br />
Upto 10 ng of sample was prepared using Takara’s SMART-Seq v4 Ultra Low Input RNA protocol per manufacturer’s guidelines. Briefly, RNA underwent reverse transcription via template switching and amplification, resulting in double stranded cDNA. The amount of cDNA between 100-3000 bp was calculated by Fragment Analyzer and Qubit. 150pg of the sample in range was then added to Illumina’s Nextera XT and processed according to manufacturer’s guidelines. Briefly, the cDNA underwent tagmentation, using Nextera XT’s transposase, and unique dual indexes were added by PCR amplification. Final libraries went through QC with the Fragment Analyzer and qPCR on a Roche Light Cycler 480 II. All libraries were then pooled and sequenced at single-end 40 base-pair using the Illumina HiSeq 2500. Demultiplexed sequencing data was handed over.<br />
<br />
<br />
=== 10X - Single cell - 3p ===<br />
<br />
Cells were processed using the 10X Genomics Chromium Controller with the Single Cell 3ʹ v3 Reagent Kit, according to manufacturer’s directions. Briefly, a target number of cells per library was roughly achieved by loading 1.6 times the target number of cells in suspension, along with barcoded beads and partitioning oil, into the Chromium Controller, in order to create GEMs (Gel Beads in Emulsion). The Chromium Controller combines individual cells, first strand master mix, and gel beads containing barcoded oligonucleotides into single-cell droplets for first strand cDNA synthesis, so that each cell is marked with its own unique barcode during reverse transcription. After first strand synthesis is complete, the emulsion is dissolved and the cDNA is pooled for bulk processing as a single sample. The sample is fragmented, end-repaired, A-tailed and ligated with universal adapters. A second sample barcode is then added during the PCR step, allowing for unique library identification. The end result is a single library representing one cell suspension, containing data for each individual cell. Samples were then sequenced using an Illumina HiSeq 2500 with a read length of 28x40 base pairs.<br />
<br />
<br />
'''Genome core switched to v3 kit in May 2019. Some preps may have been done in v2 due to specific requests from users. Typically the lane annotation file's prep method column would indicate if v3 was used for the preps'''<br />
<br />
<br />
= Sequencing =<br />
<br />
All libraries are qPCR'ed using KAPA qPCR library quant kit as per manufacturers protocol. The samples are loaded on the HiSeq 2500/NovaSeq 6000 based on qPCR concentrations.<br />
<br />
<br />
= Data Processing =<br />
<br />
All data is preprocessed and converted to FASTQ format. Please refer to the section [[SequencingFormats|Sequencing Format]] for details. Format of FASTQ can be converted using the script available under [[Scripts|Scripts]].<br />
<br />
Single cell 10x data is processed using cellranger pipeline and hence the above links do not apply to it.</div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18780Pricing2023-05-12T11:38:44Z<p>Sgupta: /* MiSeq */</p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,850<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,245<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,620<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,510<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,920<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,730<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$4,065<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$5,200<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,480<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,750<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 50 Single End<br />
|rowspan="2"|1 lane<br />
|$3,780<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,400<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v2 70 Single End or 30x30 Paired End|Flowcell|$1,320| 10 million reads}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,430| 20 million reads}}<br />
{{PricingRow|MiSeq v2 300 Single End or 150x150 Paired End|Flowcell|$1,595| 10 million reads}}<br />
{{PricingRow|MiSeq v2 500 Single End or 250x250 Paired End|Flowcell|$1,760| 10 million reads}}<br />
{{PricingLastRow|MiSeq v3 600 Single End or 300x300 Paired End|Flowcell|$2,200| 20 million reads}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
=== Standard (Manual) ===<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
=== Highthroughput (96 well Plate Based) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep (IDT xGen RNA)<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3" width=50%| Samples should be pre-aliquoted (in Eppendorf twin.tec semi-skirted 96 well plate), normalized (100 and 500 ng total), in a volume of 50 ul. <br />
Intake QC or quantification only by special arrangement at an additional charge. please inquire if needed.<br />
<br />
Libraries are pooled by FA quantification, expect variation in read balancing. <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
=== Single Cell (10X and 96 well plate based) ===<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|Plexwell Rapid Single Cell - one 96 well plate|96 well plate|$5060|1 cell per well}}<br />
{{PricingLastRow|Plexwell Rapid Single Cell - 1 of 4 96 well plates|96 well plate|$3800|1 cell per well}}<br />
<br />
<br><br />
<br />
= 10X Chromium Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X 5' VDJ Add-On|sample|$210|}}<br />
{{PricingRow|10X ADT/HTO/CellPlex Add-on|sample|$105|}}<br />
{{PricingLastRow|10X Multiome Assay (ATAC + 3')|sample|$3675|}}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= RNA Isolation =<br />
{{PricingHeader}}<br />
{{PricingRow|[http://genomecore.wi.mit.edu/index.php/rnaextraction RNA-miRNeasy Total RNA Isolation]|sample|$100|}}<br />
{{PricingLastRow|[http://genomecore.wi.mit.edu/index.php/rnaextraction RNA - MagMax mirVana RNA Isolation]|sample|$30|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
<br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18779Pricing2023-05-12T11:37:57Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,850<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,245<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,620<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,510<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,920<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,730<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$4,065<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$5,200<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,480<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,750<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 50 Single End<br />
|rowspan="2"|1 lane<br />
|$3,780<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,400<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v2 70 Single End or 30x30 Paired End|Flowcell|$770| 10 million reads}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,430| 20 million reads}}<br />
{{PricingRow|MiSeq v2 300 Single End or 150x150 Paired End|Flowcell|$1,595| 10 million reads}}<br />
{{PricingRow|MiSeq v2 500 Single End or 250x250 Paired End|Flowcell|$1,760| 10 million reads}}<br />
{{PricingLastRow|MiSeq v3 600 Single End or 300x300 Paired End|Flowcell|$2,200| 20 million reads}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
=== Standard (Manual) ===<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
=== Highthroughput (96 well Plate Based) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep (IDT xGen RNA)<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3" width=50%| Samples should be pre-aliquoted (in Eppendorf twin.tec semi-skirted 96 well plate), normalized (100 and 500 ng total), in a volume of 50 ul. <br />
Intake QC or quantification only by special arrangement at an additional charge. please inquire if needed.<br />
<br />
Libraries are pooled by FA quantification, expect variation in read balancing. <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
=== Single Cell (10X and 96 well plate based) ===<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|Plexwell Rapid Single Cell - one 96 well plate|96 well plate|$5060|1 cell per well}}<br />
{{PricingLastRow|Plexwell Rapid Single Cell - 1 of 4 96 well plates|96 well plate|$3800|1 cell per well}}<br />
<br />
<br><br />
<br />
= 10X Chromium Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X 5' VDJ Add-On|sample|$210|}}<br />
{{PricingRow|10X ADT/HTO/CellPlex Add-on|sample|$105|}}<br />
{{PricingLastRow|10X Multiome Assay (ATAC + 3')|sample|$3675|}}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= RNA Isolation =<br />
{{PricingHeader}}<br />
{{PricingRow|[http://genomecore.wi.mit.edu/index.php/rnaextraction RNA-miRNeasy Total RNA Isolation]|sample|$100|}}<br />
{{PricingLastRow|[http://genomecore.wi.mit.edu/index.php/rnaextraction RNA - MagMax mirVana RNA Isolation]|sample|$30|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
<br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18778Pricing2023-03-22T21:09:12Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,850<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,245<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,620<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,510<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,920<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,730<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$4,065<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$5,200<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,480<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,750<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 50 Single End<br />
|rowspan="2"|1 lane<br />
|$3,780<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,400<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq -- 20 million reads ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,300|}}<br />
{{PricingLastRow||||}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
=== Standard (Manual) ===<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
=== Highthroughput (96 well Plate Based) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep (IDT xGen RNA)<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3" width=50%| Samples should be pre-aliquoted (in Eppendorf twin.tec semi-skirted 96 well plate), normalized (100 and 500 ng total), in a volume of 50 ul. <br />
Intake QC or quantification only by special arrangement at an additional charge. please inquire if needed.<br />
<br />
Libraries are pooled by FA quantification, expect variation in read balancing. <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
=== Single Cell (10X and 96 well plate based) ===<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|Plexwell Rapid Single Cell - one 96 well plate|96 well plate|$5060|1 cell per well}}<br />
{{PricingLastRow|Plexwell Rapid Single Cell - 1 of 4 96 well plates|96 well plate|$3800|1 cell per well}}<br />
<br />
<br><br />
<br />
= 10X Chromium Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X 5' VDJ Add-On|sample|$210|}}<br />
{{PricingRow|10X ADT/HTO/CellPlex Add-on|sample|$105|}}<br />
{{PricingLastRow|10X Multiome Assay (ATAC + 3')|sample|$3675|}}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= RNA Isolation =<br />
{{PricingHeader}}<br />
{{PricingRow|[http://genomecore.wi.mit.edu/index.php/rnaextraction RNA-miRNeasy Total RNA Isolation]|sample|$100|}}<br />
{{PricingLastRow|[http://genomecore.wi.mit.edu/index.php/rnaextraction RNA - MagMax mirVana RNA Isolation]|sample|$30|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
<br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18777Pricing2023-03-22T21:08:41Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,850<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,245<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,620<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,510<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,920<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,730<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$4,065<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$5,200<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,480<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,750<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 50 Single End<br />
|rowspan="2"|1 lane<br />
|$3,780<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,400<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq -- 20 million reads ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,300|}}<br />
{{PricingLastRow||||}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
=== Standard (Manual) ===<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
=== Highthroughput (96 well Plate Based) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep (IDT xGen RNA)<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3" width=50%| Samples should be pre-aliquoted (in Eppendorf twin.tec semi-skirted 96 well plate), normalized (100 and 500 ng total), in a volume of 50 ul. <br />
Intake QC or quantification only by special arrangement at an additional charge. please inquire if needed.<br />
<br />
Libraries are pooled by FA quantification, expect variation in read balancing. <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
=== Single Cell (10X and 96 well plate based) ===<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|Plexwell Rapid Single Cell - one 96 well plate|96 well plate|$5060|1 cell per well}}<br />
{{PricingLastRow|Plexwell Rapid Single Cell - 1 of 4 96 well plates|96 well plate|$3800|1 cell per well}}<br />
<br />
<br><br />
<br />
= 10X Chromium Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X 5' VDJ Add-On|sample|$210|}}<br />
{{PricingRow|10X ADT/HTO/CellPlex Add-on|sample|$105|}}<br />
{{PricingLastRow|10X Multiome Assay (ATAC + 3')|sample|$3675|}}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= RNA Isolation =<br />
{{PricingHeader}}<br />
{{PricingRow|[http://genomecore.wi.mit.edu/index.php/rnaextraction RNA-miRNeasy Total RNA Isolation]|sample|$100|}}<br />
{{PricingLastRow|RNA - MagMax mirVana RNA Isolation|sample|$30|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
<br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Rnaextraction&diff=18776Rnaextraction2023-03-22T21:05:09Z<p>Sgupta: Created page with "=== RNA Extraction === We are pleased to offer two methods of RNA extraction. Both methods retain total RNA, including small RNAs. == Qiagen miRNeasy == For most low- to me..."</p>
<hr />
<div>=== RNA Extraction ===<br />
We are pleased to offer two methods of RNA extraction. Both methods retain total RNA, including small RNAs. <br />
<br />
== Qiagen miRNeasy ==<br />
For most low- to medium-throughput experiments, we recommend the column-based Qiagen miRNeasy. <br />
<br />
https://www.qiagen.com/us/products/discovery-and-translational-research/dna-rna-purification/rna-purification/mirna/mirneasy-kits?catno=217004<br />
<br />
This kit purifies RNA from up to 5 mg tissue, or cells (up to 1 x 106 cells).<br />
<br />
Samples should be provided to the Genome Core frozen in exactly 700 ul of Qiazol (please reach out to us, we can supply this), or Trizol. Please do not use >700 ul of Qiazol. <br />
<br />
== MagMAX mirVana ==<br />
For high throughput projects, we recommend the 96-well, plate-based MagMAX mirVana Total RNA Isolation Kit from Thermo Fisher. <br />
<br />
https://www.thermofisher.com/order/catalog/product/A27828<br />
<br />
This kit purifies RNA from 10-30 mg of tissue or 1 × 106 cells.<br />
<br />
Samples should be provided to the Genome Core frozen in the MagMax Processing Plate in MagMax Lysis Binding Mix (please reach out to us, we can supply these), according to your project’s unique specifications. We will work with you to make sure that you have all of the information and supplies.</div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18775Pricing2023-02-23T20:47:36Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,850<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,245<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,620<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,510<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,920<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,730<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$4,065<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$5,200<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,480<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,750<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 50 Single End<br />
|rowspan="2"|1 lane<br />
|$3,780<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,400<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq -- 20 million reads ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,300|}}<br />
{{PricingLastRow||||}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
=== Standard (Manual) ===<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
=== Highthroughput (96 well Plate Based) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep (IDT xGen RNA)<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3" width=50%| Samples should be pre-aliquoted (in Eppendorf twin.tec semi-skirted 96 well plate), normalized (100 and 500 ng total), in a volume of 50 ul. <br />
Intake QC or quantification only by special arrangement at an additional charge. please inquire if needed.<br />
<br />
Libraries are pooled by FA quantification, expect variation in read balancing. <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
=== Single Cell (10X and 96 well plate based) ===<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|Plexwell Rapid Single Cell - one 96 well plate|96 well plate|$5060|1 cell per well}}<br />
{{PricingLastRow|Plexwell Rapid Single Cell - 1 of 4 96 well plates|96 well plate|$3800|1 cell per well}}<br />
<br />
<br><br />
<br />
= 10X Chromium Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X 5' VDJ Add-On|sample|$210|}}<br />
{{PricingRow|10X ADT/HTO/CellPlex Add-on|sample|$105|}}<br />
{{PricingLastRow|10X Multiome Assay (ATAC + 3')|sample|$3675|}}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= RNA Isolation =<br />
{{PricingHeader}}<br />
{{PricingRow|RNA-miRNeasy Total RNA Isolation|sample|$100|}}<br />
{{PricingLastRow|RNA - MagMax mirVana RNA Isolation|sample|$30|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
<br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18774Pricing2023-02-03T17:43:33Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,849.50<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,241<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,619<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,510<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,916<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,726<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$4,063.50<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$5,197.50<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,480<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,750<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 50 Single End<br />
|rowspan="2"|1 lane<br />
|$3,780<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,400<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq -- 20 million reads ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,300|}}<br />
{{PricingLastRow||||}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
=== Standard (Manual) ===<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
=== Highthroughput (96 well Plate Based) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep (IDT xGen RNA)<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3" width=50%| Samples should be pre-aliquoted (in Eppendorf twin.tec semi-skirted 96 well plate), normalized (100 and 500 ng total), in a volume of 50 ul. <br />
Intake QC or quantification only by special arrangement at an additional charge. please inquire if needed.<br />
<br />
Libraries are pooled by FA quantification, expect variation in read balancing. <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
=== Single Cell (10X and 96 well plate based) ===<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|Plexwell Rapid Single Cell - one 96 well plate|96 well plate|$5060|1 cell per well}}<br />
{{PricingLastRow|Plexwell Rapid Single Cell - 1 of 4 96 well plates|96 well plate|$3800|1 cell per well}}<br />
<br />
<br><br />
<br />
= 10X Chromium Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X 5' VDJ Add-On|sample|$210|}}<br />
{{PricingRow|10X ADT/HTO/CellPlex Add-on|sample|$105|}}<br />
{{PricingLastRow|10X Multiome Assay (ATAC + 3')|sample|$3675|}}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= RNA Isolation =<br />
{{PricingHeader}}<br />
{{PricingRow|RNA-miRNeasy Total RNA Isolation|sample|$100|}}<br />
{{PricingLastRow|RNA - MagMax mirVana RNA Isolation|sample|$30|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
<br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18773Pricing2023-02-03T17:42:34Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,849.50<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,075<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,619<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,510<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,916<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,726<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$4,063.50<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$5,197.50<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,480<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,750<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 50 Single End<br />
|rowspan="2"|1 lane<br />
|$3,780<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,400<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq -- 20 million reads ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,300|}}<br />
{{PricingLastRow||||}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
=== Standard (Manual) ===<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
=== Highthroughput (96 well Plate Based) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep (IDT xGen RNA)<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3" width=50%| Samples should be pre-aliquoted (in Eppendorf twin.tec semi-skirted 96 well plate), normalized (100 and 500 ng total), in a volume of 50 ul. <br />
Intake QC or quantification only by special arrangement at an additional charge. please inquire if needed.<br />
<br />
Libraries are pooled by FA quantification, expect variation in read balancing. <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
=== Single Cell (10X and 96 well plate based) ===<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|Plexwell Rapid Single Cell - one 96 well plate|96 well plate|$5060|1 cell per well}}<br />
{{PricingLastRow|Plexwell Rapid Single Cell - 1 of 4 96 well plates|96 well plate|$3800|1 cell per well}}<br />
<br />
<br><br />
<br />
= 10X Chromium Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X 5' VDJ Add-On|sample|$210|}}<br />
{{PricingRow|10X ADT/HTO/CellPlex Add-on|sample|$105|}}<br />
{{PricingLastRow|10X Multiome Assay (ATAC + 3')|sample|$3675|}}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= RNA Isolation =<br />
{{PricingHeader}}<br />
{{PricingRow|RNA-miRNeasy Total RNA Isolation|sample|$100|}}<br />
{{PricingLastRow|RNA - MagMax mirVana RNA Isolation|sample|$30|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
<br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=SingleCell&diff=18772SingleCell2023-01-21T19:39:29Z<p>Sgupta: </p>
<hr />
<div>We offer two types of single-cell sequencing: plexWell Rapid, and 10X Genomics. <br />
<br />
= 10X Genomics =<br />
''Scale – up to 10,000 cells per library''<br />
<br />
''Input – fresh cultures < ~30 minutes old''<br />
<br />
''Output – Counts - one read (close to the polyA tail) per RNA molecule''<br />
<br />
https://www.10xgenomics.com/single-cell/<br />
<br />
Each 10X Genomics Single Cell 3’ RNA-seq library is derived from a pool of freshly-cultured, live cells, with up to 10,000 cells per sample. A single run can prepare up to 8 pools simultaneously, allowing for the preparation of up to 80,000 cells per processing run. The Chromium Controller is an instrument which combines individual cells and gel beads (GEMs) containing barcoded oligos into droplets prior to cDNA synthesis, so that each cell is represented by its own unique barcode prior to lysis and pooling. The barcoded DNA is then used to prepare a standard Illumina library. The end result is a single library containing data for each individual cell.<br />
<br />
The user provides a freshly collected cell suspension on the day of processing. '''[[You must coordinate an appointment time with the Genome Core to allow for immediate processing after cell collection and counting. The user is responsible for obtaining cell counts and percent viability prior to arrival for the appointment]]'''. Detailed protocols are available from the Genome Core. <br />
<br />
Please refer to our FAQ section for commonly asked questions: http://genomecore.wi.mit.edu/index.php/Faq#10X_Single_Cell_RNA<br />
<br />
Please review the 10X FAQ on Single Cell Seq: https://kb.10xgenomics.com/hc/en-us/categories/201931746-General-Single-Cell-RNA-seq<br />
<br />
<br />
= plexWell Rapid =<br />
''Scale – up to 96 cells per plate/library''<br />
<br />
''Input – sorted cells in lysis buffer, frozen after lysis''<br />
<br />
''Output – Counts - Multiple reads across full length of the molecule''<br />
<br />
PlexWell Rapid Single Cell RNA Library Prep Kits enable the construction of 96 or 384 transcriptome libraries from single cells, or from 2-10 ng of purified, total RNA. PlexWell generates 96 individually barcoded cDNAs via transposase reactions, and then collapses them into a single, multiplexed library using universal primers. The 384 sample kit comes in versions A, B, & C to allow users to multi-plex up to 1152 samples, if required. The resulting single-cell libraries are typically pooled (96 to a pool) for Illumina sequencing, resulting in one final library sample per plate of cells. <br />
<br />
The user should submit sorted cells in Eppendorf Twin-Tec plates, resuspended in a specific lysis buffer and frozen at -80ºC. Detailed instructions are available from the Genome Core. These plates are fairly stable, so the sorting does not need to be coordinated with the Genome Core prior to submission.</div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=SingleCell&diff=18771SingleCell2023-01-21T19:39:11Z<p>Sgupta: </p>
<hr />
<div>We offer two types of single-cell sequencing: SMART-Seq2, and 10X Genomics. <br />
<br />
= 10X Genomics =<br />
''Scale – up to 10,000 cells per library''<br />
<br />
''Input – fresh cultures < ~30 minutes old''<br />
<br />
''Output – Counts - one read (close to the polyA tail) per RNA molecule''<br />
<br />
https://www.10xgenomics.com/single-cell/<br />
<br />
Each 10X Genomics Single Cell 3’ RNA-seq library is derived from a pool of freshly-cultured, live cells, with up to 10,000 cells per sample. A single run can prepare up to 8 pools simultaneously, allowing for the preparation of up to 80,000 cells per processing run. The Chromium Controller is an instrument which combines individual cells and gel beads (GEMs) containing barcoded oligos into droplets prior to cDNA synthesis, so that each cell is represented by its own unique barcode prior to lysis and pooling. The barcoded DNA is then used to prepare a standard Illumina library. The end result is a single library containing data for each individual cell.<br />
<br />
The user provides a freshly collected cell suspension on the day of processing. '''[[You must coordinate an appointment time with the Genome Core to allow for immediate processing after cell collection and counting. The user is responsible for obtaining cell counts and percent viability prior to arrival for the appointment]]'''. Detailed protocols are available from the Genome Core. <br />
<br />
Please refer to our FAQ section for commonly asked questions: http://genomecore.wi.mit.edu/index.php/Faq#10X_Single_Cell_RNA<br />
<br />
Please review the 10X FAQ on Single Cell Seq: https://kb.10xgenomics.com/hc/en-us/categories/201931746-General-Single-Cell-RNA-seq<br />
<br />
<br />
= plexWell Rapid =<br />
''Scale – up to 96 cells per plate/library''<br />
<br />
''Input – sorted cells in lysis buffer, frozen after lysis''<br />
<br />
''Output – Counts - Multiple reads across full length of the molecule''<br />
<br />
PlexWell Rapid Single Cell RNA Library Prep Kits enable the construction of 96 or 384 transcriptome libraries from single cells, or from 2-10 ng of purified, total RNA. PlexWell generates 96 individually barcoded cDNAs via transposase reactions, and then collapses them into a single, multiplexed library using universal primers. The 384 sample kit comes in versions A, B, & C to allow users to multi-plex up to 1152 samples, if required. The resulting single-cell libraries are typically pooled (96 to a pool) for Illumina sequencing, resulting in one final library sample per plate of cells. <br />
<br />
The user should submit sorted cells in Eppendorf Twin-Tec plates, resuspended in a specific lysis buffer and frozen at -80ºC. Detailed instructions are available from the Genome Core. These plates are fairly stable, so the sorting does not need to be coordinated with the Genome Core prior to submission.</div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=SingleCell&diff=18770SingleCell2023-01-21T19:38:43Z<p>Sgupta: </p>
<hr />
<div>We offer two types of single-cell sequencing: SMART-Seq2, and 10X Genomics. <br />
<br />
= 10X Genomics =<br />
''Scale – up to 10,000 cells per library''<br />
<br />
''Input – fresh cultures < ~30 minutes old''<br />
<br />
''Output – Counts - one read (close to the polyA tail) per RNA molecule''<br />
<br />
https://www.10xgenomics.com/single-cell/<br />
<br />
Each 10X Genomics Single Cell 3’ RNA-seq library is derived from a pool of freshly-cultured, live cells, with up to 10,000 cells per sample. A single run can prepare up to 8 pools simultaneously, allowing for the preparation of up to 80,000 cells per processing run. The Chromium Controller is an instrument which combines individual cells and gel beads (GEMs) containing barcoded oligos into droplets prior to cDNA synthesis, so that each cell is represented by its own unique barcode prior to lysis and pooling. The barcoded DNA is then used to prepare a standard Illumina library. The end result is a single library containing data for each individual cell.<br />
<br />
The user provides a freshly collected cell suspension on the day of processing. '''[[You must coordinate an appointment time with the Genome Core to allow for immediate processing after cell collection and counting. The user is responsible for obtaining cell counts and percent viability prior to arrival for the appointment]]'''. Detailed protocols are available from the Genome Core. <br />
<br />
Please refer to our FAQ section for commonly asked questions: http://genomecore.wi.mit.edu/index.php/Faq#10X_Single_Cell_RNA<br />
<br />
Please review the 10X FAQ on Single Cell Seq: https://kb.10xgenomics.com/hc/en-us/categories/201931746-General-Single-Cell-RNA-seq<br />
<br />
<br />
= SMART-Seq2 =<br />
''Scale – up to 96 cells per plate/library''<br />
<br />
''Input – sorted cells in lysis buffer, frozen after lysis''<br />
<br />
''Output – Counts - Multiple reads across full length of the molecule''<br />
<br />
PlexWell Rapid Single Cell RNA Library Prep Kits enable the construction of 96 or 384 transcriptome libraries from single cells, or from 2-10 ng of purified, total RNA. PlexWell generates 96 individually barcoded cDNAs via transposase reactions, and then collapses them into a single, multiplexed library using universal primers. The 384 sample kit comes in versions A, B, & C to allow users to multi-plex up to 1152 samples, if required. The resulting single-cell libraries are typically pooled (96 to a pool) for Illumina sequencing, resulting in one final library sample per plate of cells. <br />
<br />
The user should submit sorted cells in Eppendorf Twin-Tec plates, resuspended in a specific lysis buffer and frozen at -80ºC. Detailed instructions are available from the Genome Core. These plates are fairly stable, so the sorting does not need to be coordinated with the Genome Core prior to submission.</div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18769Pricing2023-01-19T19:24:48Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,712.50<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,075<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,425<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,250<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,700<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,450<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$3,762.50<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$4,812.50<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,000<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,375<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 35 Single End<br />
|rowspan="2"|1 lane<br />
|$3,600<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,000<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq -- 20 million reads ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,300|}}<br />
{{PricingLastRow||||}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
=== Standard (Manual) ===<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
=== Highthroughput (96 well Plate Based) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep (IDT xGen RNA)<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3" width=50%| Samples should be pre-aliquoted (in Eppendorf twin.tec semi-skirted 96 well plate), normalized (100 and 500 ng total), in a volume of 50 ul. <br />
Intake QC or quantification only by special arrangement at an additional charge. please inquire if needed.<br />
<br />
Libraries are pooled by FA quantification, expect variation in read balancing. <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
=== Single Cell (10X and 96 well plate based) ===<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|Plexwell Rapid Single Cell - one 96 well plate|96 well plate|$5060|1 cell per well}}<br />
{{PricingLastRow|Plexwell Rapid Single Cell - 1 of 4 96 well plates|96 well plate|$3800|1 cell per well}}<br />
<br />
<br><br />
<br />
= 10X Chromium Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X 5' VDJ Add-On|sample|$210|}}<br />
{{PricingRow|10X ADT/HTO/CellPlex Add-on|sample|$105|}}<br />
{{PricingLastRow|10X Multiome Assay (ATAC + 3')|sample|$3675|}}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= RNA Isolation =<br />
{{PricingHeader}}<br />
{{PricingRow|RNA-miRNeasy Total RNA Isolation|sample|$100|}}<br />
{{PricingLastRow|RNA - MagMax mirVana RNA Isolation|sample|$30|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
<br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18768Pricing2023-01-19T19:23:26Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,712.50<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,075<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,425<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,250<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,700<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,450<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$3,762.50<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$4,812.50<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,000<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,375<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 35 Single End<br />
|rowspan="2"|1 lane<br />
|$3,600<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,000<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq -- 20 million reads ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,300|}}<br />
{{PricingLastRow||||}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
=== Standard (Manual) ===<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
=== Highthroughput (96 well Plate Based) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3" width=50%| Samples should be pre-aliquoted (in Eppendorf twin.tec semi-skirted 96 well plate), normalized (100 and 500 ng total), in a volume of 50 ul. <br />
Intake QC or quantification only by special arrangement at an additional charge. please inquire if needed.<br />
<br />
Libraries are pooled by FA quantification, expect variation in read balancing. <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
=== Single Cell (10X and 96 well plate based) ===<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|Plexwell Rapid Single Cell - one 96 well plate|96 well plate|$5060|1 cell per well}}<br />
{{PricingLastRow|Plexwell Rapid Single Cell - 1 of 4 96 well plates|96 well plate|$3800|1 cell per well}}<br />
<br />
<br><br />
<br />
= 10X Chromium Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X 5' VDJ Add-On|sample|$210|}}<br />
{{PricingRow|10X ADT/HTO/CellPlex Add-on|sample|$105|}}<br />
{{PricingLastRow|10X Multiome Assay (ATAC + 3')|sample|$3675|}}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= RNA Isolation =<br />
{{PricingHeader}}<br />
{{PricingRow|RNA-miRNeasy Total RNA Isolation|sample|$100|}}<br />
{{PricingLastRow|RNA - MagMax mirVana RNA Isolation|sample|$30|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
<br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18767Pricing2023-01-19T19:22:07Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,712.50<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,075<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,425<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,250<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,700<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,450<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$3,762.50<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$4,812.50<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,000<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,375<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 35 Single End<br />
|rowspan="2"|1 lane<br />
|$3,600<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,000<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq -- 20 million reads ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,300|}}<br />
{{PricingLastRow||||}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
=== Standard (Manual) ===<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
=== Highthroughput (96 well Plate Based) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3"| Samples should be pre-aliquoted (in Eppendorf twin.tec semi-skirted 96 well plate), normalized (100 and 500 ng total), in a volume of 50 ul. <br />
Intake QC or quantification only by special arrangement at an additional charge. please inquire if needed. <br />
Libraries are pooled by FA quantification, expect variation in read balancing. <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
=== Single Cell (10X and 96 well plate based) ===<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|Plexwell Rapid Single Cell - one 96 well plate|96 well plate|$5060|1 cell per well}}<br />
{{PricingLastRow|Plexwell Rapid Single Cell - 1 of 4 96 well plates|96 well plate|$3800|1 cell per well}}<br />
<br />
<br><br />
<br />
= 10X Chromium Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X 5' VDJ Add-On|sample|$210|}}<br />
{{PricingRow|10X ADT/HTO/CellPlex Add-on|sample|$105|}}<br />
{{PricingLastRow|10X Multiome Assay (ATAC + 3')|sample|$3675|}}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= RNA Isolation =<br />
{{PricingHeader}}<br />
{{PricingRow|RNA-miRNeasy Total RNA Isolation|sample|$100|}}<br />
{{PricingLastRow|RNA - MagMax mirVana RNA Isolation|sample|$30|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
<br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18766Pricing2023-01-19T19:21:28Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,712.50<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,075<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,425<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,250<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,700<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,450<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$3,762.50<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$4,812.50<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,000<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,375<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 35 Single End<br />
|rowspan="2"|1 lane<br />
|$3,600<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,000<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq -- 20 million reads ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,300|}}<br />
{{PricingLastRow||||}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
=== Standard (Manual) ===<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
=== Highthroughput (96 well Plate Based) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3"| Samples should be pre-aliquoted (in Eppendorf twin.tec semi-skirted 96 well plate), normalized (100 and 500 ng total), in a volume of 50 ul. Intake QC or quantification only by special arrangement at an additional charge. please inquire if needed. Libraries are pooled by FA quantification, expect variation in read balancing. <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
=== Single Cell (10X and 96 well plate based) ===<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|Plexwell Rapid Single Cell - one 96 well plate|96 well plate|$5060|1 cell per well}}<br />
{{PricingLastRow|Plexwell Rapid Single Cell - 1 of 4 96 well plates|96 well plate|$3800|1 cell per well}}<br />
<br />
<br><br />
<br />
= 10X Chromium Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X 5' VDJ Add-On|sample|$210|}}<br />
{{PricingRow|10X ADT/HTO/CellPlex Add-on|sample|$105|}}<br />
{{PricingLastRow|10X Multiome Assay (ATAC + 3')|sample|$3675|}}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= RNA Isolation =<br />
{{PricingHeader}}<br />
{{PricingRow|RNA-miRNeasy Total RNA Isolation|sample|$100|}}<br />
{{PricingLastRow|RNA - MagMax mirVana RNA Isolation|sample|$30|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
<br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Main_Page&diff=18765Main Page2023-01-19T19:04:45Z<p>Sgupta: </p>
<hr />
<div>{| style="font-style:italic; font-size:120%; width:100%; border:2px solid white; height:100px" align="center"<br />
|-<br />
| [[image:Lab-Panorama-shot-web.jpg|center]]<br />
|-<br />
|}<br />
{| style="background:white; color:black; width:800px" align="center"<br />
|<br />
{|<br />
|<br />
{| style="border:1px solid purple; width:800px; height:100px; text-align: center" align="center"<br />
| valign="top" | Services<br />
{| style="text-align: left; width:100%"<br />
|<br />
[[Pricing|'''CLICK HERE FOR PRICE LIST''']]<br />
<br />
Service Details:<br />
* [[Sequencing|Sequencing]] <br />
* [[LibraryPrep|Library Prep]] <br />
* [[SingleCell|Single Cell Sequencing]]<br />
* [[RT_PCR|Real-Time PCR]]<br />
* Bioanalyzer<br />
|}<br />
|}<br />
{| style="background:white; color:black; width:800px" align="center"<br />
|<br />
{| style="border:1px solid purple; width:400px; height:140px; text-align: center"<br />
| valign="top" | Hot Links<br />
{| style="text-align: left; width:100%" <br />
|<br />
* [https://cores.wi.mit.edu/ External Lab Customer Registration]<br />
* [[Forms|Sample Submission Forms (All Services)]]<br />
* [[SubmissionGuide|Sequencing Sample Submission Guide]]<br />
* [[Calendar|Resource Scheduling Systems for RT PCR and Covaris]]<br />
* [[faq|Frequently Asked Questions]]<br />
|}<br />
|}<br />
||<br />
{| style="border:1px solid purple; width:400px; height:140px; text-align: center"<br />
| valign="top" | Data Related Resources<br />
{| style="text-align: left; width:100%" <br />
|<br />
* [[SequencingQC|Sequencing QC]]<br />
* [[SequencingFormats|Sequencing Formats]]<br />
* Analysis - [[Scripts|Scripts]], [[Data_Analysis_Resources|Other Resources]]<br />
* [[General_Links_Resources|General Links]]<br />
* [[NCBISubmission|NCBI Submission Guide]]<br />
|}<br />
|}<br />
|<br />
|}<br />
{| style="background:white; color:black; width:800px" align="center"<br />
|<br />
{| style="border:1px solid purple; width:400px; height:120px; text-align: center"<br />
| valign="top" | Contact Us<br />
{| style="text-align: center; width:100%" <br />
|<br />
455 Main Street, <br> <br />
Cambridge, MA - 02142 <br><br />
Tel: 617-258-8803 <br><br />
[[wibr-genome at wi dot mit dot edu]]<br />
|}<br />
|}<br />
||<br />
{| style="border:1px solid purple; width:400px; height:120px; text-align: center"<br />
| valign="top" | Other General Information<br />
{| style="text-align: left; width:100%" <br />
|<br />
* [[Personnel]] - [[Tom_Volkert|Tom Volkert]], [[Jennifer_Love|Jennifer Love]], [[Sumeet_Gupta|Sumeet Gupta]], Stephen Mraz III, Amanda Chilaka<br />
|}<br />
|}<br />
|<br />
|}<br />
|}<br />
|}</div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Main_Page&diff=18764Main Page2023-01-19T19:04:18Z<p>Sgupta: </p>
<hr />
<div>{| style="font-style:italic; font-size:120%; width:100%; border:2px solid white; height:100px" align="center"<br />
|-<br />
| [[image:Lab-Panorama-shot-web.jpg|center]]<br />
|-<br />
|}<br />
{| style="border:1px solid red; color: white; text-align: center; width:800px" align="center"<br />
|-<br />
| <h6 align="center"> <br />
</h6><br />
|-<br />
|}<br />
{| style="background:white; color:black; width:800px" align="center"<br />
|<br />
{|<br />
|<br />
{| style="border:1px solid purple; width:800px; height:100px; text-align: center" align="center"<br />
| valign="top" | Services<br />
{| style="text-align: left; width:100%"<br />
|<br />
[[Pricing|'''CLICK HERE FOR PRICE LIST''']]<br />
<br />
Service Details:<br />
* [[Sequencing|Sequencing]] <br />
* [[LibraryPrep|Library Prep]] <br />
* [[SingleCell|Single Cell Sequencing]]<br />
* [[RT_PCR|Real-Time PCR]]<br />
* Bioanalyzer<br />
|}<br />
|}<br />
{| style="background:white; color:black; width:800px" align="center"<br />
|<br />
{| style="border:1px solid purple; width:400px; height:140px; text-align: center"<br />
| valign="top" | Hot Links<br />
{| style="text-align: left; width:100%" <br />
|<br />
* [https://cores.wi.mit.edu/ External Lab Customer Registration]<br />
* [[Forms|Sample Submission Forms (All Services)]]<br />
* [[SubmissionGuide|Sequencing Sample Submission Guide]]<br />
* [[Calendar|Resource Scheduling Systems for RT PCR and Covaris]]<br />
* [[faq|Frequently Asked Questions]]<br />
|}<br />
|}<br />
||<br />
{| style="border:1px solid purple; width:400px; height:140px; text-align: center"<br />
| valign="top" | Data Related Resources<br />
{| style="text-align: left; width:100%" <br />
|<br />
* [[SequencingQC|Sequencing QC]]<br />
* [[SequencingFormats|Sequencing Formats]]<br />
* Analysis - [[Scripts|Scripts]], [[Data_Analysis_Resources|Other Resources]]<br />
* [[General_Links_Resources|General Links]]<br />
* [[NCBISubmission|NCBI Submission Guide]]<br />
|}<br />
|}<br />
|<br />
|}<br />
{| style="background:white; color:black; width:800px" align="center"<br />
|<br />
{| style="border:1px solid purple; width:400px; height:120px; text-align: center"<br />
| valign="top" | Contact Us<br />
{| style="text-align: center; width:100%" <br />
|<br />
455 Main Street, <br> <br />
Cambridge, MA - 02142 <br><br />
Tel: 617-258-8803 <br><br />
[[wibr-genome at wi dot mit dot edu]]<br />
|}<br />
|}<br />
||<br />
{| style="border:1px solid purple; width:400px; height:120px; text-align: center"<br />
| valign="top" | Other General Information<br />
{| style="text-align: left; width:100%" <br />
|<br />
* [[Personnel]] - [[Tom_Volkert|Tom Volkert]], [[Jennifer_Love|Jennifer Love]], [[Sumeet_Gupta|Sumeet Gupta]], Stephen Mraz III, Amanda Chilaka<br />
|}<br />
|}<br />
|<br />
|}<br />
|}<br />
|}</div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18763Pricing2023-01-19T18:59:46Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,712.50<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,075<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,425<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,250<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,700<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,450<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$3,762.50<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$4,812.50<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,000<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,375<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 35 Single End<br />
|rowspan="2"|1 lane<br />
|$3,600<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,000<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq -- 20 million reads ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,300|}}<br />
{{PricingLastRow||||}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
=== Standard (Manual) ===<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
=== Highthroughput (96 well Plate Based) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3"| <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
=== Single Cell (10X and 96 well plate based) ===<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|Plexwell Rapid Single Cell - one 96 well plate|96 well plate|$5060|1 cell per well}}<br />
{{PricingLastRow|Plexwell Rapid Single Cell - 1 of 4 96 well plates|96 well plate|$3800|1 cell per well}}<br />
<br />
<br><br />
<br />
= 10X Chromium Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X 5' VDJ Add-On|sample|$210|}}<br />
{{PricingRow|10X ADT/HTO/CellPlex Add-on|sample|$105|}}<br />
{{PricingLastRow|10X Multiome Assay (ATAC + 3')|sample|$3675|}}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= RNA Isolation =<br />
{{PricingHeader}}<br />
{{PricingRow|RNA-miRNeasy Total RNA Isolation|sample|$100|}}<br />
{{PricingLastRow|RNA - MagMax mirVana RNA Isolation|sample|$30|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
<br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18762Pricing2023-01-19T18:57:32Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,712.50<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,075<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,425<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,250<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,700<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,450<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$3,762.50<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$4,812.50<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,000<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,375<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 35 Single End<br />
|rowspan="2"|1 lane<br />
|$3,600<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,000<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq -- 20 million reads ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,300|}}<br />
{{PricingLastRow||||}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
=== Standard (Manual) ===<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
=== Highthroughput (96 well Plate Based) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3"| <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
=== Single Cell (10X and 96 well plate based) ===<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|Plexwell Rapid Single Cell - one 96 well plate|96 well plate|$5060|1 cell per well}}<br />
{{PricingLastRow|Plexwell Rapid Single Cell - 1 of 4 96 well plates|96 well plate|$3800|1 cell per well}}<br />
<br />
<br><br />
<br />
= 10X Chromium Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X 5' VDJ Add-On|sample|$210|}}<br />
{{PricingRow|10X ADT/HTO/CellPlex Add-on|sample|$105|}}<br />
{{PricingLastRow|10X Multiome Assay (ATAC + 3')|sample|$3675|}}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= RNA Isolation =<br />
{{PricingHeader}}<br />
{{PricingRow|RNA-miRNeasy Total RNA Isolation|sample|$100|}}<br />
{{PricingLastRow|RNA - MagMax mirVana RNA Isolation|sample|$30|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18761Pricing2023-01-19T18:50:50Z<p>Sgupta: /* Single Cell */</p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,712.50<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,075<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,425<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,250<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,700<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,450<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$3,762.50<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$4,812.50<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,000<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,375<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 35 Single End<br />
|rowspan="2"|1 lane<br />
|$3,600<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,000<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq -- 20 million reads ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,300|}}<br />
{{PricingLastRow||||}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
=== Standard (Manual) ===<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
=== Highthroughput (96 well Plate Based) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3"| <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
=== Single Cell (10X and 96 well plate based) ===<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|Plexwell Rapid Single Cell - one 96 well plate|96 well plate|$5060|1 cell per well}}<br />
{{PricingLastRow|Plexwell Rapid Single Cell - 1 of 4 96 well plates|96 well plate|$3800|1 cell per well}}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= RNA Isolation =<br />
{{PricingHeader}}<br />
{{PricingRow|RNA-miRNeasy Total RNA Isolation|sample|$100|}}<br />
{{PricingLastRow|RNA - MagMax mirVana RNA Isolation|sample|$30|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18760Pricing2023-01-19T18:48:57Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,712.50<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,075<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,425<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,250<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,700<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,450<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$3,762.50<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$4,812.50<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,000<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,375<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 35 Single End<br />
|rowspan="2"|1 lane<br />
|$3,600<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,000<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq -- 20 million reads ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,300|}}<br />
{{PricingLastRow||||}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
=== Standard (Manual) ===<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
=== Highthroughput (96 well Plate Based) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3"| <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
=== Single Cell ===<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|Plexwell Rapid Single Cell - one 96 well plate|96 well plate|$5060|1 cell per well}}<br />
{{PricingLastRow|Plexwell Rapid Single Cell - 1 of 4 96 well plates|96 well plate|$3800|1 cell per well}}<br />
<br />
<br><br />
<br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= RNA Isolation =<br />
{{PricingHeader}}<br />
{{PricingRow|RNA-miRNeasy Total RNA Isolation|sample|$100|}}<br />
{{PricingLastRow|RNA - MagMax mirVana RNA Isolation|sample|$30|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18759Pricing2023-01-19T18:48:36Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,712.50<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,075<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,425<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,250<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,700<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,450<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$3,762.50<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$4,812.50<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,000<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,375<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 35 Single End<br />
|rowspan="2"|1 lane<br />
|$3,600<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,000<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq -- 20 million reads ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,300|}}<br />
{{PricingLastRow||||}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
=== Standard (Manual) ===<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
=== Highthroughput (96 well Plate Based) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3"| <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
=== Single Cell ===<br />
{{PricingHeader}}<br />
{{PricingRow|10X Single Cell 3’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|10X Single Cell 5’ Solution Library prep|sample|$2362|}}<br />
{{PricingRow|Plexwell Rapid Single Cell - one 96 well plate|96 well plate|$5060|1 cell per well}}<br />
{{PricingLastRow|Plexwell Rapid Single Cell - 1 of 4 96 well plates|96 well plate|$3800|}}<br />
<br />
<br><br />
<br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= RNA Isolation =<br />
{{PricingHeader}}<br />
{{PricingRow|RNA-miRNeasy Total RNA Isolation|sample|$100|}}<br />
{{PricingLastRow|RNA - MagMax mirVana RNA Isolation|sample|$30|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18758Pricing2023-01-19T18:32:16Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,712.50<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,075<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,425<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,250<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,700<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,450<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$3,762.50<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$4,812.50<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,000<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,375<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 35 Single End<br />
|rowspan="2"|1 lane<br />
|$3,600<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,000<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq -- 20 million reads ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,300|}}<br />
{{PricingLastRow||||}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
= Highthroughput (96 well Plate Based) RNA Library Prep =<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep<br />
| 48 Samples<br />
|$3600<br />
|rowspan="3"| <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18757Pricing2023-01-19T18:31:18Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,712.50<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,075<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,425<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,250<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,700<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,450<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$3,762.50<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$4,812.50<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,000<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,375<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 35 Single End<br />
|rowspan="2"|1 lane<br />
|$3,600<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,000<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq -- 20 million reads ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,300|}}<br />
{{PricingLastRow||||}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
= Highthroughput (96 well Plate Based) RNA Library Prep =<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep<br />
| <br />
| 48 Samples<br />
|$3600<br />
|rowspan="3"| <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18756Pricing2023-01-19T18:30:54Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,712.50<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,075<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,425<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,250<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,700<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,450<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$3,762.50<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$4,812.50<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,000<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,375<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 35 Single End<br />
|rowspan="2"|1 lane<br />
|$3,600<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,000<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq -- 20 million reads ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,300|}}<br />
{{PricingLastRow||||}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
= Highthroughput (96 well Plate Based) RNA Library Prep =<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="3"|HT mRNA library prep<br />
| <br />
| 48 Samples<br />
|$3600<br />
|rowspan="3"| <br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
|}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18755Pricing2023-01-19T18:25:32Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,712.50<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,075<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,425<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,250<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,700<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,450<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$3,762.50<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$4,812.50<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,000<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,375<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 35 Single End<br />
|rowspan="2"|1 lane<br />
|$3,600<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,000<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq -- 20 million reads ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,300|}}<br />
{{PricingLastRow||||}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
= Highthroughput (96 well Plate Based) RNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|rowspan="3"|HT mRNA library prep<br />
|- <br />
| 48 Samples<br />
|$3600<br />
|-<br />
| 49-72 samples<br />
|$5400<br />
|-<br />
| 96 samples<br />
|$7200<br />
|-<br />
}}<br />
{{PricingLastRow||||}}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18754Pricing2023-01-19T18:22:02Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,712.50<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,075<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,425<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,250<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,700<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,450<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$3,762.50<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$4,812.50<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,000<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,375<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 35 Single End<br />
|rowspan="2"|1 lane<br />
|$3,600<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,000<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq -- 20 million reads ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,300|}}<br />
{{PricingLastRow||||}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
= Highthroughput (96 well Plate Based) RNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|HT mRNA library prep|48 Samples|$3600|}}<br />
{{PricingRow|HT mRNA library prep|49-72 samples|$5400|}}<br />
{{PricingLastRow|HT mRNA library prep|96 samples|$7200|}}<br />
<br />
<br><br />
<br />
= DNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|Swift ChIP|sample|$200|Optimized for low input ChIP}}<br />
{{PricingRow|Nextera gDNA (Genomic, ATAC-Seq)|sample|$200|"Tagmentation" prep from intact gDNA (50ng)}}<br />
{{PricingLastRow|Illumina DNA Prep (Genomic)|sample|$200|Genomic DNA >100ng}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Main_Page&diff=18753Main Page2023-01-19T18:14:39Z<p>Sgupta: </p>
<hr />
<div>{| style="font-style:italic; font-size:120%; width:100%; border:2px solid white; height:100px" align="center"<br />
|-<br />
| [[image:Lab-Panorama-shot-web.jpg|center]]<br />
|-<br />
|}<br />
{| style="border:1px solid red; color: white; text-align: center; width:800px" align="center"<br />
|-<br />
| <h6 align="center"> The Genome Technology Core is open and accepting samples for most services. Samples may be submitted as usual through the [http://gtc.wi.mit.edu/apps/ online portal]. Internal customers may leave samples in the [[Special:Redirect/file/dropoff.png|drop box in the -80C freezer in the hallway outside room 325]]. External customers should mail samples or contact GTC staff to schedule a sample exchange at the building entrance. <br><br><br />
<br />
The Real-time PCR machines and Covaris system have been moved to room 360. Please reserve 2 hour blocks for these instruments on our resource scheduling calendar. ([[Calendar|Resource Scheduling Systems for RT PCR and Covaris]]). The Nanodrop and Qubit systems are also in room 360 and are available for walk-up use as long as nobody else is in the room. Only one person in room 360 at a time please.<br />
</h6><br />
|-<br />
|}<br />
{| style="background:white; color:black; width:800px" align="center"<br />
|<br />
{|<br />
|<br />
{| style="border:1px solid purple; width:800px; height:100px; text-align: center" align="center"<br />
| valign="top" | Services<br />
{| style="text-align: left; width:100%"<br />
|<br />
[[Pricing|'''CLICK HERE FOR PRICE LIST''']]<br />
<br />
Service Details:<br />
* [[Sequencing|Sequencing]] <br />
* [[LibraryPrep|Library Prep]] <br />
* [[SingleCell|Single Cell Sequencing]]<br />
* [[RT_PCR|Real-Time PCR]]<br />
* Bioanalyzer<br />
|}<br />
|}<br />
{| style="background:white; color:black; width:800px" align="center"<br />
|<br />
{| style="border:1px solid purple; width:400px; height:140px; text-align: center"<br />
| valign="top" | Hot Links<br />
{| style="text-align: left; width:100%" <br />
|<br />
* [https://cores.wi.mit.edu/ External Lab Customer Registration]<br />
* [[Forms|Sample Submission Forms (All Services)]]<br />
* [[SubmissionGuide|Sequencing Sample Submission Guide]]<br />
* [[Calendar|Resource Scheduling Systems for RT PCR and Covaris]]<br />
* [[faq|Frequently Asked Questions]]<br />
|}<br />
|}<br />
||<br />
{| style="border:1px solid purple; width:400px; height:140px; text-align: center"<br />
| valign="top" | Data Related Resources<br />
{| style="text-align: left; width:100%" <br />
|<br />
* [[SequencingQC|Sequencing QC]]<br />
* [[SequencingFormats|Sequencing Formats]]<br />
* Analysis - [[Scripts|Scripts]], [[Data_Analysis_Resources|Other Resources]]<br />
* [[General_Links_Resources|General Links]]<br />
* [[NCBISubmission|NCBI Submission Guide]]<br />
|}<br />
|}<br />
|<br />
|}<br />
{| style="background:white; color:black; width:800px" align="center"<br />
|<br />
{| style="border:1px solid purple; width:400px; height:120px; text-align: center"<br />
| valign="top" | Contact Us<br />
{| style="text-align: center; width:100%" <br />
|<br />
455 Main Street, <br> <br />
Cambridge, MA - 02142 <br><br />
Tel: 617-258-8803 <br><br />
[[wibr-genome at wi dot mit dot edu]]<br />
|}<br />
|}<br />
||<br />
{| style="border:1px solid purple; width:400px; height:120px; text-align: center"<br />
| valign="top" | Other General Information<br />
{| style="text-align: left; width:100%" <br />
|<br />
* [[Personnel]] - [[Tom_Volkert|Tom Volkert]], [[Jennifer_Love|Jennifer Love]], [[Sumeet_Gupta|Sumeet Gupta]], Stephen Mraz III, Amanda Chilaka<br />
|}<br />
|}<br />
|<br />
|}<br />
|}<br />
|}</div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18752Pricing2023-01-19T18:14:05Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,712.50<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,075<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,425<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,250<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,700<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,450<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$3,762.50<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$4,812.50<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,000<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,375<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 35 Single End<br />
|rowspan="2"|1 lane<br />
|$3,600<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,000<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq -- 20 million reads ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,300|}}<br />
{{PricingLastRow||||}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
= Highthroughput (96 well Plate Based) RNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|HT mRNA library prep|48 Samples|$3600|}}<br />
{{PricingRow|HT mRNA library prep|49-72 samples|$5400|}}<br />
{{PricingLastRow|HT mRNA library prep|96 samples|$7200|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br />
<br><br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18751Pricing2023-01-19T18:13:42Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,712.50<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,075<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,425<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,250<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,700<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,450<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$3,762.50<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$4,812.50<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,000<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,375<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 35 Single End<br />
|rowspan="2"|1 lane<br />
|$3,600<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,000<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq -- 20 million reads ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,300|}}<br />
{{PricingLastRow||||}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
= Highthroughput (96 well Plate Based) RNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|HT mRNA library prep|48 Samples|$3600|}}<br />
{{PricingRow|HT mRNA library prep|49-72 samples|$5400|}}<br />
{{PricingLastRow|HT mRNA library prep|96 samples|$7200|}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br><br />
<br />
<br />
= nCounter Analysis System (NanoString) =<br />
{{PricingHeader}}<br />
{{PricingRow|Reagents|Cartridge|----|Reagents and Codesets Purchase From Nanostring}}<br />
{{PricingRow|Equipment Use|Cartridge|$250|12 samples per cartridge}}<br />
{{PricingRow|Labor-Hyb|Cartridge|$150|-}}<br />
{{PricingLastRow|Labor-miRNA|Sample|$25|Addon for miRNA protocol only}}<br />
<br />
<br><br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sguptahttp://genomecore.wi.mit.edu/index.php?title=Pricing&diff=18750Pricing2023-01-19T18:09:23Z<p>Sgupta: </p>
<hr />
<div>Prices quoted are for Whitehead Institute/MIT only. In order to cover additional costs associated with providing outside service, non-WI/MIT institutions should add 30% to the list price.<br />
<br />
<br />
= Illumina Sequencing =<br />
<br />
There are three options for Illumina sequencing. NovaSeq and MiSeq.<br />
<br />
Prices include basic data processing including base calls, quality scores and alignment (if requested). <br />
<br />
Please visit the [http://jura.wi.mit.edu/genomecorewiki/index.php/Sequencing Sequencing Services] page for sample submission instructions and more information about library prep services. <br />
<br />
=== NovaSeq (Single lane submissions accepted for standard read lengths) ===<br />
<br />
{| style="text-align: center; width:1000px; font-size:120%; border:3px dashed red;" border="1" align="center"<br />
|-<br />
| Item || Read Length || Unit || Price Per Unit || Notes<br />
|- <br />
|rowspan="4"|NovaSeqSP<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="4"| 1 lane<br />
|$1,712.50<br />
|rowspan="4"|~650–800 million reads per flowcell <br>~325-400 million reads per lane <br>(x2 for Paired-End) <br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$2,075<br />
|- <br />
| 300 Single End or 150x150 Paired-End<br />
|$2,425<br />
|-<br />
| 500 Single End or 250x250 Paired-End<br />
|$3,250<br />
|-<br />
|rowspan="3"|NovaSeqS1<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$2,700<br />
|rowspan="3"|~1.3–1.6 billion reads per flowcell <br> ~650–800 million reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$3,450<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$3,762.50<br />
|-<br />
|rowspan="3"|NovaSeqS2<br />
| 100 Single End or 50x50 Paired-End<br />
|rowspan="3"|1 lane<br />
|$4,812.50<br />
|rowspan="3"|~3.3–4.1 billion reads per flowcell <br> ~1.65-2.05 billion reads per lane <br> (x2 for Paired-End)<br />
|- <br />
| 200 Single End or 100x100 Paired-End<br />
|$6,000<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$6,375<br />
|-<br />
|rowspan="2"|NovaSeqS4 <br />
| 35 Single End<br />
|rowspan="2"|1 lane<br />
|$3,600<br />
|rowspan="2"|~8-10 billion reads per flowcell <br> ~2-2.5 billion reads per lane <br> (x2 for Paired-End)<br />
|-<br />
| 300 Single End or 150x150 Paired-End<br />
|$5,000<br />
|- <br />
|}<br />
<br />
<br />
<br><br />
<br />
=== MiSeq -- 20 million reads ===<br />
{{PricingHeader}}<br />
{{PricingRow|MiSeq v3 150 Single End or 75x75 Paired End|Flowcell|$1,300|}}<br />
{{PricingLastRow||||}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingLastRow|NEBNext Small RNA|Sample|$200|}}<br />
<br />
<br><br />
<br />
= RNA Library Prep =<br />
{{PricingHeader}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 1-12|Sample|$200|}}<br />
{{PricingRow|IDT xGen RNA, Std or Rapid (formerly Swift), samples 13+|Sample|$150|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 1-12|Sample|$250|}}<br />
{{PricingRow|KAPA Hyper Prep Ribo Zero, samples 13+|Sample|$200|}}<br />
{{PricingRow|Agilent SureSelect All Exon|Sample|$650|}}<br />
{{PricingRow|NEBNext Small RNA|Sample|$200|}}<br />
{{PricingRow||||}}<br />
{{PricingRow|SMARTer UltraLow RNA w/ NexteraXT|Sample|$300|Low Input}}<br />
{{PricingLastRow|SMARTer Stranded Total RNA Pico|Sample|$250|Low Input}}<br />
<br />
<br><br />
<br />
= Quality Control =<br />
{{PricingHeader}}<br />
{{PricingRow|Bioanalyzer|Sample|$15|Sizing and purity analysis}}<br />
{{PricingRow|qPCR|Sample|$25|Quantification}}<br />
{{PricingLastRow|Sample Multiplexing|Sample|$10|Mixing samples for multiplex run}} <br />
<br><br />
<br />
<br />
= nCounter Analysis System (NanoString) =<br />
{{PricingHeader}}<br />
{{PricingRow|Reagents|Cartridge|----|Reagents and Codesets Purchase From Nanostring}}<br />
{{PricingRow|Equipment Use|Cartridge|$250|12 samples per cartridge}}<br />
{{PricingRow|Labor-Hyb|Cartridge|$150|-}}<br />
{{PricingLastRow|Labor-miRNA|Sample|$25|Addon for miRNA protocol only}}<br />
<br />
<br><br />
= Bioanalyzer - RNA, DNA and Protein analysis =<br />
{{PricingHeader}}<br />
{{PricingLastRow|RNA or DNA|Sample|$15|Pico, Nano, DNA or hsDNA}}<br />
<br />
<br><br />
<br />
= Quantitative PCR - QuantStudio 6 =<br />
{{PricingHeader}}<br />
{{PricingRow|SYBR green / Taq Man Master mix|uL|7 cents|-}}<br />
{{PricingRow|Optical Plate|Plate|$7|-}}<br />
{{PricingLastRow|Equipment Time (2 hour time block)|Plate|$30|Sign-up Required}}<br />
<br />
<br></div>Sgupta